Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Topic: Bioinformatics Case Control study using Perl

Considering the following sample results of a case-control study for a disease, write a Perl script named calcAlleleOdds.pl that study each position (assuming all positions are SNP positions) reporting the allele with the maximum odds ratio. Although Chi-square test is a usual test model for association studies, but we will skip it in this assignment.

You need to calculate the odds ratio for each allele, and then report the allele with the maximum odds ratio). Calculating odds ratio is provided in the Supplement slides and was discussed in the lecture/recording of Wed class.

You may face a known problem in calculating odds ratio, i.e. when the cells of the 2x2 table (that is used to calculate odds ratios) contain one or more of zero values, the solution for this problem is provided in the Supplement slides too.

In case, an allele with an odds ratio > 1.5 is found for a position, report that this position is associated with the disease.

You may copy-paste the data to a local text file so that you may read the data using the Perl script.

You will need to submit the Perl script that you made for the assignment. The output of the Perl script should be a tab-separated file named alleles.tsv that provides the following information:

Position (1-based index)

Allele

Odds ratio

Associated (Yes or No)

 

 

 

 

Cases:

TACGCAGTCGACAGGTATAGCCTACATGTACTCGACATGTACTCGGT
TACGCCGTCGACATGTATAGTCTACATGTACTCGACATGTACTCGGT
TACGCAGTCGACAGGTATAGTCTACATGTACTCGACATGTACTCGGT
TACGCAGTCGACAGGTATAGCCTACATGTACTCAACATGTACTCGGT
TACGCCGTCGACATGTATAGCCTACATGTACTCGACATGTACTCGGT
TACGCCGTCGACATGTATAGCCTACATGTACTCGACATGTACTCGGT
TACGCCGTCGACAGGTATAGCCTACATGTACTCGACATGTACTCGGT
TACGCAGTCGACAGGTATAGCCTACATGTACTCGACATGTACTCTGT

Controls:

TAGGCAGTCGATAGGTATAACCTACATGTCCTCGACAGGTACTCGGT
TAGGCGGTCGATATGTATAATCTACATGTCCTCGACAGGTACTCGGT
TAGGCAGTCGATAGGTATAATCTACATGTCCTCGACAGGTACTCGGT
TAGGCAGTCGATAGGTATAACCTACATGTCCTCAACAGGTACTCGGT
TAGGCGGTCGATATGTATAACCTACATGTCCTCGACAGGTACTCGGT
TAGGCGGTCGATATGTATAACCTACATGTCCTCGACAGGTACTCGCT
TACGCGGTCGATAGGTATAACCTACATGTCCTCGACAGGTACTCGCA
TACGCAGTCGACAGGTATAACCTACATGTACTCGACATGTACTCTCA

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92273669

Have any Question?


Related Questions in Homework Help/Study Tips

Question explain the difference between resource allocation

Question: Explain the difference between resource allocation and resource exchange as described in the Economics as the Study of Coordination and Exchange reading. What are the limitations of the allocation paradigm? How ...

Question 1you have the following rates of return for a

Question 1. You have the following rates of return for a risky portfolio for several recent years. Assume that the stock pays no dividends. - What is the geometric average return (rG) for the period? Year Beginning, of Y ...

Have you ever wondered what william shakespeares facebook

Have you ever wondered what William Shakespeare's Facebook profile would look like, assuming he was alive today? Many of the historical figures from the Humanities died long before the advent of social media; however, th ...

The purpose of this assignment is to construct and design a

The purpose of this assignment is to construct and design a research proposal. I am in need of help with constructing my research proposal paper. I have decided to whether social media has a significant effect on suicide ...

Research paper instructionswrite a research paper on topic

RESEARCH PAPER INSTRUCTIONS Write a research paper on topic - The commercial forensic packages sources used for child abuse, domestic violence, and exploitation and gambling. The outline is already written and it needs e ...

Explain how and why various research agendas are being

Explain how and why various research agendas are being constructed to address sustainability Identify how scientists see their research contributing to societal efforts to move towards a more-sustainable future (sustaina ...

Instructionsvideo usf launches new cybersecurity program

Instructions Video : USF launches new cybersecurity program (Fox13news) 1-POST SUBJECT (Enter a subject) - The level and title of your article Submit two well written paragraphs, as follows: Paragraph 1 - Summarize the a ...

Nonparental care choose one of the three nonparental care

Nonparental Care Choose one of the three nonparental care choices: nannies, center-based, or family-based care. Imagine that you are trying to sell your chosen method of care to a prospective client who is a parent of a ...

Assignment -purpose - the purpose of this report is to

Assignment - Purpose - The purpose of this report is to demonstrate research and academic literacy skills. You need to produce writing that is clear, concise and meaningful, whilst now incorporating evidence from sources ...

Question according to the american diabetes association

Question: According to the American Diabetes Association (2011), 25.8 million children and adults have been diagnosed with diabetes in the United States. Approximately 2 million more are diagnosed every year, with anothe ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As