(Answered) This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat

Others

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:dideoxy); the DNA is danatured, danaturant is removed and primer is annealed, and DNA polymerase is added.

a) What is/are the length(s) of the newly synthesized strand(s) in bases?

b) What is/are the length(s) of the newly synthesized strand(s) in bases if ddATP is excluded?

Please explain the process.

View complete question

Homework Help/Study Tips, Others

Category:- Homework Help/Study Tips
Reference No.:- M93110517
Price:- $10

Verified Expert

Priced at $20 Now at $10, Verified Solution

Have any Question?Write your Review or question?

Related Questions in Homework Help/Study Tips

The fbi and most other places that try to define white

The FBI and most other places that try to define White Collar crime (WCC) are a bit clueless. There is no such thing as a white-collar crime, as there is not a White-Collar section of the penal code. The term is a label ...

Question on the discussion forum describe an instance of

Question: On the discussion forum, describe an instance of plagiarism or other use of another's intellectual property with which you are familiar. Please give one argument condemning this conduct and one argument defendi ...

Ethical violations assessment -description - select a

Ethical Violations Assessment - Description - Select a company that has been in the news for ethical violations (for example, Enron). Assess the following in 525 to 700 words: Identify the alleged ethical violations. Det ...

Quesiton length 300-500 wordsprovide your own opinion on

Quesiton: Length: 300-500 words Provide your own opinion on the following statement: Unions and employees have to work together as partners in the best interest of the organization. (Do not conduct any research or cite a ...

Officer joanna has newly graduated from the police academy

Officer Joanna has newly graduated from the police academy and has a real passion for her work. During her day shift, she likes to position her patrol car behind some oak trees near a shopping mall that has a "stop" sign ...

Question discuss the philosophical and religious origins of

Question: Discuss the philosophical and religious origins of the Gothic style of the Middle Ages. What are the identifying elements of this style? The response must be typed, single spaced, must be in times new roman fon ...

The text mentions that the united states spends more on

The text mentions that the United States spends more on health care than any other industrialized country in the world. And yet, not all people in the U.S. have health insurance coverage. As you learned in Chapter 1, the ...

Discussion research your own personal family history for

Discussion Research your own personal family history for diseases. Outline your family history and see what major health risks run in your family How does it make you feel to know the additional risks? Were you able to i ...

Who has the greater advantage a brilliant person who cannot

Who has the greater advantage: a brilliant person who cannot communicate well, or an average person who can communicate better? Why?

Public health law and policy assessment task - legal case

PUBLIC HEALTH LAW AND POLICY Assessment Task - Legal case study addressing a public health issue Background - For this assessment task you will write a case study, in a report format, addressing the legislative and regul ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Homework Help/Study Tips Expert