Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Theory of Bureaucratic Caring and the Theory of Successful Aging

The theory of Bureaucratic Caring was introduced by the ray, and it deals with offering ethical care to oneself and the others in a certain community. The theory of Successful Aging deals with the process that people have to go through before they can stop being active in the society (In Smith, 2015).

It deals with the disengagement of the people growing older from certain activities that require active participation. In this paper, I will discuss the theory of Bureaucratic caring more than the theory of successful aging.

Bureaucratic caring is very important first to the nurses and the young health practitioners who have just graduated out of college. The nurses have to consult and collaborate with other nurses to be able to carry out their tasks smoothly. That way, caring for one another and oneself is very important.

The practice is also used in modeling future leaders in health care facilities. Good leaders should be in a position to take care of themselves and the other people around them.

Being caring to others means that you can understand how they feel or what they are going through and this is very important to nurses because they can be able to understand the conditions of a patient easily (Masters, 2015). The theory of bureaucratic caring relates well to the leadership role of nurses whereby they are required to ensure patients safety and good health by employing excellent communication skills.

As a nurse, I plan to that I have effective communication skills that will help me to communicate well with patients and other nurses. I also want to be a good leader who practices participative partnership. I will also ensure that funds and other health facilities are well distributed and are only used for their intended purpose.

I will also ensure that budgets are tight so that the little resources available can be used to benefit a large number of people. I will also be in the frontline during the formulation of rules and standards to be used in my health facility. The bureaucratic care and the successful aging theories are both aimed at providing the best health care for people vulnerable to certain illnesses in the society (Masters, 2015).

References:

In Smith, M., & In Parker, M. (2015). Nursing theories & nursing practice. Philadelphia: F.A. Davis Company.

Masters, K. (2015). Nursing theories: A framework for professional practice. Burlington, Massachusetts: Jones & Bartlett Learning.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92406288
  • Price:- $10

Priced at Now at $10, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question - from among the four alternatives given below

Question - From among the four alternatives given below, which letter replaces in the given table the question mark? 3 P 8 9 G 11 2 U 4 3 W 1 7 ? 18 A. A B. B C. S D. Y

Price theory industry analysis assignment -overview -in

Price Theory Industry Analysis Assignment - Overview - In this assessment task you will take the role of an expert economist, employed by a government department or regulatory authority. Decision-makers in government rel ...

Question in a 3 page paper please address the following

Question: In a 3 page paper, please address the following :Describe what strategic planning is and the associated steps in the planning process. How does HR planning fit into the overall strategic planning process? What ...

Question conduct an internet search about the murder of

Question: Conduct an internet search about the murder of Yeardley Love. After researching the story, write a 500¬-750-word essay addressing the following. 1. Assuming there was abuse occurring prior to the death of Yeard ...

Question post a brief summary of the article you selected

Question: Post a brief summary of the article you selected. Provide a real-world application of the theory within your current professional area or one in which you have interest. Also, explain how the theory could apply ...

Question scenario imagine that you are a co-owner andor

Question: Scenario: Imagine that you are a co-owner and/or executive-level manager of a medium-sized business. A group of business leaders from another country has expressed an interest in purchasing a franchise of your ...

Draft a 750-1000 word policy memorandum from the

Draft a 750-1000 word policy memorandum from the perspective of either the Secretary of Homeland Security or the Director of National Intelligence to either the intelligence community or the homeland security enterprise ...

Question the first step of the ebp process is to develop a

Question: The first step of the EBP process is to develop a question from the nursing practice problem of interest. Select a practice problem of interest to use as the focus of your research. Start with the patient and i ...

Part i project management planit is suggested that the

Part I: Project Management Plan It is suggested that the project you select be manageable in scope and not overly complex. You will assume that the objectives and scope of the project you have selected have been vetted a ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As