Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

The topic selected is how customer service can be improved in Melbourne's taxi industry in order to satisfy customers. in literature you have to mention opinions of other well know people in this particular industry.

Your own ideas and opinions are not required. you also have to mention the name of person whose ideas you are going to discuss. moreover 12 references to different articles or journals are required from where you will pick the data.

Task 1:

Your preliminary project proposal will need to be polished to reach the required standard before you can proceed the Capstone Project itself.

This check list will guide you on what is expected:

• What is your topic and what is its business significance?
• What questions will you research?
• What research methodologies will you deploy?
• What data will you collect?
• What data analysis will you do?
• What will be the steps in your project and what are the various target dates?
• Who is your primary mentor/supervisor?
• You will also need to attach a completed ethics checklist

Task 2: Project Literature Review:

This will consist of developing a comprehensive literature review chapter for the business research proposal. You will have to identify a business research topic, describe the literature on the research topic and provide hypotheses based on the literature for the research questions you have already defined in your research proposal.

This is an individual assignment.

Task 3: Capstone Project Report

The final research report will consist of all items included in the final report template.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91258199
  • Price:- $120

Guranteed 48 Hours Delivery, In Price:- $120

Have any Question?


Related Questions in Homework Help/Study Tips

Question write a report about the new york philharmonic

Question: Write a report about the New York Philharmonic concert performance following guidelines in the "Guide to Writing a Concert Report" and standards listed in the Concert Report Rubric. Include the following: 1) Co ...

Question read samuel gompers testimony before congress

Question: Read Samuel Gompers testimony before Congress regarding the AFL and the original platform of the Knights of Labor from the links below. What issues did labor unions attempt to resolve in the early 1900s? How su ...

Question case assignmentutilize the required readings for

Question: Case Assignment Utilize the required readings for this module and access countyhealthrankings's website to write a short paper (2-3 pages) addressing the following items in particular: 1. Describe the County He ...

Question for this assignment you will create a research

Question: For this assignment, you will create a research question, select an appropriate research method to answer that question, and discuss the appropriateness of the type of research you selected. Your title will be ...

Question healthcare ethics and healthcare reformaccording

Question: Healthcare Ethics and Healthcare Reform According to the American College of Emergency Physicians. (ACEP) (n.d.), "the enacted Affordable Care Act (PPACA) of 2010 has fueled ethical debate of several important ...

Question in this assignment you will be completing a health

Question: In this assignment, you will be completing a health assessment on an older adult. To complete this assignment, do the following: 1. Perform a health history on an older adult. Students who do not work in an acu ...

Question conduct a literature review paper 4 pages about

Question: Conduct a literature review paper (4 pages) about the impact of occupational health and safety (OHS) policies on dentists' performance in Saudi Arabia. This paper will be from an administrative point of view. ( ...

Question bullwhat are the economic costs of this health

Question: • What are the economic costs of this health problem for society, families, and individuals? • What are the social costs (cost in any means such as time, human resource, social burden) associated with this heal ...

Question prompt dayer-berenson ch 41 what potential areas

Question: Prompt: Dayer-Berenson, Ch. 4 1. What potential areas of diversity exist in your practice community? 2. How might you learn more about your local community and its unique needs? What are the barriers to meeting ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As