(Answered) The question is ann was an average young girl she was quiet

Others

The question is Ann was an average young girl. She was quiet every Sunday morning in church, because her parents always reinforced her quiet behavior there. However, on the school playground she was always loud and boisterous, because these behaviours were reinforced by her friends there.

Is this an example of stimulus discrimination training or no?

View complete question

Homework Help/Study Tips, Others

Category:- Homework Help/Study Tips
Reference No.:- M92095991
Price:- $10

Verified Expert

Priced at $20 Now at $10, Verified Solution

Have any Question?Write your Review or question?

Related Questions in Homework Help/Study Tips

Question conducting a community assessment is more

Question: Conducting a community assessment is more complicated and challenging in practice than it appears on paper or in theory. A community assessment provides a baseline measure of a variety of conditions and resourc ...

Assignment compensation analysis hr graduate classto obtain

Assignment: Compensation Analysis. HR graduate class. To obtain and retain the best and the brightest talent in an industry, an organization should pay particular attention to its compensation practices. With that a back ...

Question it is well known in the us that disadvantaged

Question: It is well known in the US that disadvantaged children do not get the same education. But, in other countries such as parts of China, Singapore, and Japan have less of a gap in educational success no matter the ...

Assignment rationale for agency selectedfor this and the

Assignment : Rationale for Agency Selected For this and the following assignments, which will become a major part of your portfolio, you will take on the role of a consultant for a government agency. The first role of th ...

Question topic 2 disaster managementcontact your local

Question: Topic 2: Disaster Management Contact your local public health department to learn about its role in a local disaster, including the role of the nurses who work there. I called the ......... county health depart ...

Question privacy laws in other countries are an important

Question: Privacy laws in other countries are an important concern when performing cloud forensics and investigations. You've been assigned a case involving PII data stored on a cloud in Australia. Before you start any d ...

Question describe one innovative health care delivery model

Question: Describe one innovative health care delivery model that incorporates an interdisciplinary care delivery team. How is this advantageous to patient outcomes? The response must be typed, single spaced, must be in ...

Question vaccine controversies have occurred since almost

Question: Vaccine controversies have occurred since almost 80 years before the terms vaccine and vaccination were introduced, and continue to this day. Despite scientific consensus that recommended vaccines are safe and ...

Question psychologists like b f skinner have studied how we

Question: Psychologists like B. F. Skinner have studied how we can use operant conditioning to change the behavior of people and animals. Drawing on your personal experience, choose a person or animal whose behavior you ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Homework Help/Study Tips Expert