Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

The learning activity and corresponding assignment in this topic requires students to perform a heritage assessment with families selected by students from their local communities.

Interview three families from different cultures. One family should be from your own culture. Compare the differences in health traditions between these cultures.

Assess the three families using the "Heritage Assessment Tool." In 1,000-1,500 words, discuss the usefulness of applying a heritage assessment to evaluate the needs of families and develop plans for health maintenance, health protection, and health restoration. Include the following:

Perform a heritage assessment on three families. One of these families should be from your own culture.

You are not required to include the tool in your LoudCloud submission.

Identify common health traditions based on cultural heritage. Evaluate and discuss how the families subscribe to these traditions and practices.

Address health maintenance, health protection, and health restoration as they relate to your assessment.
Prepare this assignment according to the guidelines found in the APA Style Guide, located in the Student Success Center. An abstract is not required.

This assignment uses a rubric. Please review the rubric prior to beginning the assignment to become familiar with the expectations for successful completion.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92580478
  • Price:- $40

Priced at Now at $40, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Instructionswrite a 700- to 1050-word paper describing an

INSTRUCTIONS Write a 700- to 1,050-word paper describing an informal learning experience you have had. You may describe, for example, how you became afraid of heights, why a particular food or smell moves you emotionally ...

Question tell me your favorite place to be describe it

Question: Tell me your favorite place to be. Describe it, giving me details so i can "see" it in my mind. Use as many senses as you can to describe it. What kinds of things do you like to do there, and why do you think i ...

Case study critiques instructionsyou are required to write

Case Study Critiques Instructions You are required to write critiques of 2 case studies in the course based on the articles provided in the assigned modules/weeks' Reading & Study folders. Each case study critique must b ...

Question what is the johnson amendment explain its history

Question : What is the "Johnson Amendment?" Explain its history, as well as the arguments pro and con regarding it. What has President Trump said and done about the amendment? What is its legal status now? Be specific in ...

Question in attempt to alleviate debt crisis and negotiate

Question: In attempt to alleviate debt crisis and negotiate with the World Bank or IMF, what are some of the stabilization policies developing countries must face? The response must be typed, single spaced, must be in ti ...

Question with instructor approval students will select an

Question: With instructor approval, students will select an organization that either has or is experiencing challenges with its compensation and benefit system. The student will provide a brief historical view of the org ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Do you agree that the hippocratic oath that physicians must

Do you agree that the Hippocratic Oath that physicians must take upon their entry into the profession provides a strong foundation for medical ethics? Why, or why not? Please include the name of the person or question to ...

Question we are now in week 5 of the class at the end of

Question: We are now in week 5 of the class. At the end of this week, you are going to submit a memo to your instructor stating the topic of your proposed white paper and the audience for whom it is intended. In this dis ...

Question choose a country that manufactures clothing and

Question: Choose a country that manufactures clothing and shoes for major brands across the world. What are their labor policies and discuss if they act responsibility to their employees. Discuss the concept of fair trad ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As