The last line in a book is what the evidence shouts most, Ask an Expert

Others

The last line in a book is "what the evidence shouts most loudly is striking, liberating news: that great performance is not reserved for a preordained few. It is available to you and to everyone." This is an extraordinary statement. Do you agree? Explain in a detailed post.

Since the word entrepreneur means one who takes action, what does his last sentence mean for a world where currently 2 billion people are online? And what does this mean for the future when 4 billion are expected to be online by 2050?

View complete question

Homework Help/Study Tips, Others

Category:- Homework Help/Study Tips
Reference No.:- M9901325

Have any Question?Write your Review or question?

Related Questions in Homework Help/Study Tips

Question prepare a 700- to 1050-word paper defining

Question: Prepare a 700- to 1,050-word paper defining warehousing and discussing its strategic role within the logistics system. Discuss the role of warehousing in a logistics system. Differentiate between the different ...

Question 2- to 4-page paper that includes the

Question: 2- to 4-page paper that includes the following: 1. Describe two historical events that you believe contributed most to the field of addictions. • Explain the contribution of each event to the contemporary field ...

Question read four 4 academically reviewed articles on

Question: Read Four (4) academically reviewed articles on Cyber Security and Risk Management and complete the following activities:(Wikipedia articles will not be accepted. Professor may check originality of all posts. A ...

Use the lesson planning ideas for integration document to

Use the "Lesson Planning Ideas for Integration" document to brainstorm ideas for a music lesson plan for Birth to Age 5/Pre-K. Use the format of one of the "Lesson Plan Templates" and one of your ideas to create and impl ...

Discipline investigation about preschool teacher step 1

DISCIPLINE INVESTIGATION about preschool teacher Step 1: Interview For this assignment, you will interview a professional in your field of study to gain insight into your future discourse community. Try to select someone ...

Question evolving practice of nursing and patient care

Question: Evolving Practice of Nursing and Patient Care Delivery Models As the country focuses on the restructuring of the U.S. health care delivery system, nurses will continue to play an important role. It is expected ...

Question 350 word forumdiscuss victimization as a result

Question: 350 word forum Discuss victimization as a result date rape drugs. Do you feel these types of assaults should be handled differently by the courts than date rapes that occur when the victim consumes too much alc ...

Note for this assignment of total 6 pages all in apa

Note: For this assignment of total 6 pages, All in APA format 3-1 Mini-Case Analysis: Cyclosporine ( two pages) Instructions Read the case study "Cyclospora in the Wedding Cake" and then write a short case analysis addre ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question project overviewpurpose the purpose of this

Question: Project Overview Purpose: The purpose of this semester-long Project is to demonstrate that you possess the knowledge, skills, and other appropriate capabilities to design a detailed, comprehensive, and plausibl ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Homework Help/Study Tips Expert