Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

The focus of the capstone project is to solve a contemporary social and criminal justice issue through the application of information from a variety of related fields, which may include sociology, law, psychology, and ethics.

In developing a proposed solution to a modern social and criminal justice issue, you are encouraged to use scholarly and primary sources, multimedia, and interviews with professionals in the field (if possible) to identify and devise a workable plan.

Within the Final Capstone Project, complete the following:

Identify a clear thesis statement to address your chosen criminal and social justice issue.

Summarize your chosen social and criminal justice issue.

Propose the resolution to the social and criminal justice issue.

Examine the operations of the criminal justice system as it relates to your chosen issue and resolution. This may include operations related to crime scene investigation techniques and security; the collection, preservation and presentation of evidence; and processes related to correctional institutions, incarceration, and release.

Analyze how the criminal and social justice theories (in relation to the United States Constitution) and landmark U.S. Supreme Court decisions impact your chosen issue and support your resolution.

Explain how social and criminal justice systems promote social equality and fairness for all and how this impacts your issue and resolution. Consider how poverty, racism, and religion apply to contemporary social and criminal justice.

Assess how the centralization of criminal justice agencies in the United States, The Patriot Act, the U.S. Homeland Security Act, and international aspects of social and criminal justice impact your issue and resolution.

Identify and describe at least two careers in criminal justice (existing or to-be-created) for agencies that may be involved in addressing the issue and resolution you have chosen.

The paper must be at least 20 pages in length, excluding title and reference pages, and formatted according to APA styl

You must use at least ten scholarly resources (at least four of which can be found in the Ashford Online Library) other than the textbook to support your claims.

You may consider referencing documentaries, contemporary news reports, multimedia, and interviews with professionals in the field. Cite your sources within the text of your paper and on the reference page.

For information regarding APA, including samples and tutorials, visit the Ashford Writing Center, located within the Learning Resources tab on the left navigation toolbar, in your online course.

Writing the Final Capstone Project

The Final Capstone Project:

Must be at least 20 double-spaced pages in length, and formatted according to APA style as outlined in the Ashford Writing Center.

Must include a title page with the following:

Title of paper

Student's name

Course name and number

Instructor's name

Date submitted

Must begin with an introductory paragraph that has a succinct thesis statement.

Must address the topic of the paper with critical thought.

Must end with a conclusion that reaffirms your thesis.

Must use at least ten scholarly resources, including a minimum of four from the Ashford University Library.

Must document all sources in APA style, as outlined in the Ashford Writing Center.

Must include a separate reference page, formatted according to APA style as outlined in the Ashford Writing Center.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92862761

Have any Question?


Related Questions in Homework Help/Study Tips

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Assessment task planning implementation and evaluation of a

Assessment task: Planning, implementation and evaluation of a non-communicable disease prevention initiative This assignment uses a suburban state primary school as a setting for the prevention of overweight and obesity. ...

Question 2 paragraphs for each answering all questions1

Question: 2 paragraphs for each answering ALL Questions: 1) What recommendations would you make to union and management leadership in order to meet the demands of a constantly changing workplace? What are some possible w ...

Health information technology1healthcareinformation

Health Information Technology 1. Healthcareinformation exchanges (HIEs) are maturing and providing opportunities for healthcare providers and payers to collaborate on patient healthcare records and to streamline care. Th ...

Assignmentidentify and read two to three articles that

Assignment Identify and read two to three articles that discuss the cost and benefits associated with the initiative you have selected. Note: If relevant articles are not found in the University Library, expand your sear ...

Question threat modeling and security testing are similar

Question: Threat modeling and security testing are similar in regard to both serve the purpose of addressing risk, however, both have their own respective specific purpose. For this assignment identify and explain the ke ...

Discussion metatheories of childrearingconsider the

Discussion: Metatheories of Childrearing Consider the following two quotes by infant/toddler expert Ronald Lally: "Every single adult, whether conscious of it or not, has an overarching theory that drives his or her chil ...

Library and internet research exercise - note-taking and

Library and Internet Research Exercise - Note-Taking and Paraphrasing Attached is an example of integrating the two previous sources into one paragraph in a research paper. Notice the various ways the sources are credite ...

Assignment 2 required assignment 1-strategic alliances and

Assignment 2: Required Assignment 1-Strategic Alliances and Human Resource Management Background: LGE is one of the leading global companies in the industry. It is composed of five divisions: air conditioning, business s ...

How do sanctions work why are they so effective in

How do sanctions work? Why are they so effective in maintaining social order? To address these questions, you will violate a social folkway. Select one of the options below. You may not choose something that is not on th ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As