Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Test Questions

Multiple choice: Circle the letter of that best applies to each question.

The Office of Technology Assessment's reports have included the following subjects:

A. The price of tea in China.
B. The decommissioning of nuclear power plants.
C. The street layout of St. Paul, MN.
D. The future of Digital Television.

Short answer essays: Write organized, concise answers to the following questions. (Point value in parentheses at the end of each question)

Why were OTA reports considered to be of high quality? (5)

Long answer essays/opinions.

Author Allen Mazur states, "Technical controversies are part of the normal flow of political activity. Therefore it seems reasonable to decide the political issues raised in these controversies in the same way we decide other political issues." Do you agree or disagree with this statement? Explain. (10)

Review of Lectures

What are the purposes of Technological Assessment? How is this process similar and different from Environmental Assessment?

Historical Analogy: The United Kingdom become a world leader in sailing/shipping technology. How did that result in them also advancing other technologies?

What is the electromagnetic spectrum? What types of technology use the spectrum? How does the government regulate the spectrum? Why? How does the government benefit from the electromagnetic spectrum?

What are the advantages and disadvantages of the following methods of technology assessment: Delphi, extrapolation, interrogation, historical analogy, scenarios.

Define the following: Project-induced technology assessment, Problem-induced technology assessment, Technology-induced technology assessment.

Why is regulation of technology by society (often government, but also through social norms) necessary?

What technology assessment made Amory Lovins famous? What technology is Lovins forecasting now and how is he trying to influence society to make that forecast come true?

Explain the perspective of technology "questioners" such as Neil Postman? How is this different from the perspective of technology assessment advocates such as Joseph Coates?

What is sustainable development and how could it be assessed? Why would we want it to be assessed?

What are the differences between hazards and risks? How do we (as individuals and societies) deal with reducing risk? How does the government reduce risk?

Videos

How does Ray Kurzweil think technology will transform us? What are Niall Ferguson's six killer apps of prosperity?

Does Malcolm Gladwell think that the advances in weapons technology in 20th and 21st centuries are a good thing? What has been the unintended consequence of this advancement?

Review of Technology and the Future Reading Assignments

What is the main point of Leo Marx's article, Does improved Technology mean Progress? Robert Pool gives examples of trade-offs in technology in the chapter How Society Shapes Technology. What are some of these examples?

Why does Edward Tenner consider shoelaces to be a technology?

What is Social Engineering as defined by Alvin Weinberg? What is a technology fix? Which is easier and why is it easier?

Why does Samuel Florman describe technology as tragic? Does he have a point?

What are some of the examples of old technology that are being used in new ways and in new places?

Why does Bill Joy think that technology could replace humans? Why do other people (such as John Seely Brown and Paul Duguid) disagree?

How does Ray Kurweil describe "The Law of Accelerating Returns?"

How do author Jack Dempsey and The 9/11 Commission think that the need for security and the need for civil liberties should be balanced?

What issue about stem cells leads to what author Christopher Thomas Scott (and others) call the Great Moral divide?

Why is the author of The Case Against Perfection against perfection of human muscles and brain function, or is he? What are some examples from his writing?

According to Henry T. Greely, how could advances in neuroscience affect health care, schools, business, and criminal justice.

What are the advantages and disadvantages of computers? Why were computers impact on society underestimated in the past? How are computers used unethically?

Wendell Berry is against computers. Why?

Give examples of how the government has mandated the use of technology to solve a problem and where it has banned a technological application to solve a problem. What other entities beside governments have been about to change how societies use technologies?

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92039981
  • Price:- $50

Priced at Now at $50, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question 1the two major cell types that make up the nervous

Question: 1. The two major cell types that make up the nervous system are cells and . 2. Almost all hormone secretion is under the control of the gland, which is in turn controlled by the . 3. The basal ganglia include t ...

Question throughout this course you will conduct a strategy

Question: Throughout this course, you will conduct a strategy audit for a selected company. Begin this assignment by selecting an organization for your course project activities. In this module, you will assess the produ ...

Question for your initial post to this discussion develop a

Question: For your initial post to this discussion, develop a case note about a client session you recently completed. Use the Signs and Symptoms, Topics of Discussion, Interventions, Progress and Plan, and Special Issue ...

To help you preparenbspthink about the data you collected

To help you prepare   Think about the data you collected, why you chose those particular data, and your data collection processes, including how you used collaboration in your process. · After analyzing your data, create ...

Assignment 1 discussion-television charactertelevision

Assignment 1: Discussion-Television Character Television provides us with many interesting examples of interpersonal and neurotic behaviors. In this assignment, you will delve into the life and actions of some of your fa ...

Every act of conscious learning requires the willingness to

Every act of conscious learning requires the willingness to suffer an injury to one's self-esteem. That is why young children, before they are aware of their own self-importance, learn so easily. ~Thomas Szasz Discussion ...

Body composition research 2 different body composition

Body Composition: Research 2 different body composition formulas. Some may be for specific populations (athletes, elderly, cardiac), some might use body density and some may use circumference measurements. · What variabl ...

Question module 1 - slpintroduction to ethical and legal

Question: Module 1 - SLP Introduction To Ethical And Legal Perspectives In Healthcare As a healthcare professional, you are among a group of frontline workers. Frontline workers are the backbone of effective health syste ...

Part 1 critical thinking in criminal Part 1: Critical Thinking in Criminal Justice

Part 1: Critical Thinking in Criminal Justice Assignment Answer the following questions: 4.1: What is a theory? Why is it important to understand the various theories of criminal behavior? 4.2 Research Cesare Beccaria's ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As