Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Somatoform, Dissociative, and Sexual Disorders

In completing the case study, students will be addressing the following learning objectives:

Describe possible etiologies of somatoform disorders.

Explain the features of various somatoform disorders.

Identify the most common interdisciplinary goals and treatments for clients with somatoform disorders.

1. Roger is a 60-year-old, twice-divorced, Hispanic man who is retired. His only support system is two adult sons with whom he has a distant relationship. Roger has medical insurance from his retirement and constantly complains that he has some medical problem. He "doctor shops" by seeing different doctors for his various complaints. Roger is always asking the doctors if he needs surgery. In the past 5 years, he has undergone an exploratory laparotomy for complaints of abdominal pain, three colonoscopies for complaints of alternate diarrhea and constipation, and numerous diagnostic tests for his many physical complaints. All tests and procedures have negative findings for any physical basis. Roger remains convinced that he has multiple problems that the doctors are unable to diagnose.

a. What are somatoform disorders, and what are the types of this disorder?

b. Based on the information given in the case study, what contributing factors do you believe Roger has? What other factors, not included, could contribute to somatoform disorders? Name the appropriate disciplines involved in the treatment of Roger and the interdisciplinary goals and interventions in treating his somatoform disorder.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92456561
  • Price:- $10

Priced at Now at $10, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

There areone short videos and answer some simple questions

There areone short videos, and answer some simple questions. Do not need to write too much details for each questions, just use simple and easy words as you can. FSF #38: John Williams - The Raiders march (Raiders of the ...

Question sandie friedmans this way for vampires teaching

Question: Sandie Friedman's "This Way for Vampires: Teaching First-Year Composition in 'Challenging Times.'" The past two weeks I've asked you to work quite a bit with Sandie Friedman's "This Way for Vampires: Teaching F ...

Instructionsyou have been hired by a general contractor to

Instructions You have been hired by a general contractor to provide safety training for 20 construction workers. The first training module will be for fall protection during roofing projects. The workers may work on proj ...

Assignmentconflict may occur in many different aspects of

Assignment Conflict may occur in many different aspects of people's lives, and how individuals respond to conflict may differ depending on the situation. This assignment provides the opportunity to apply what you have le ...

Question describe the concepts of balanced scorecard and

Question: Describe the concepts of balanced scorecard and dashboard. How can these tools be used to improve financial performance? The response must be typed, single spaced, must be in times new roman font (size 12) and ...

Critical thinking research assignment juvenile life

Critical Thinking Research Assignment : Juvenile Life Sentences Ruled Unconstitutional Utilizing the elements of Critical Thinking, you learned in the first assignment, research the topic listed and write an essay (minim ...

Question suppose that you created an robot that was so

Question: Suppose that you created an robot that was so advanced it could act independently in very complex situations. It made its own decisions and always did exactly what it wanted to do, in accordance with its progra ...

Question identify a research or evidence-based article that

Question: Identify a research or evidence-based article that focuses comprehensively on a specific intervention or new diagnostic tool for the treatment of diabetes in adults or children. In a paper of 750-1,000 words, s ...

Assignment - effect of solid wastes on environmental

Assignment - Effect of Solid Wastes on Environmental Pollution The improper disposal of solid wastes, resulting from several activities, can give rise to unhygienic conditions and therefore cause environmental pollution. ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As