Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Socialization: This is a term utilized in the social sciences that define the procedure by which individuals get the cultural & social requirements, like, values, language , norms , customs and traditions, to function normally in a specific society. Socialization can take place through self-conformity or through society-imposed expectations.

Questions: I need a report on Socialization. Socialization report for about 2500 words? Would you able to assist me in report? Let me know cost of report and some of examples of pervious reports.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M9531689

Have any Question?


Related Questions in Homework Help/Study Tips

Consider how nature and nurture are intertwined in their

Consider how nature and nurture are intertwined in their influence on personality. Which human personality traits do you think are more influenced by nature, and which do you think are more influenced by nurture? Explain ...

Question select one of the paraphilias or one of the eating

Question: Select one of the Paraphilias or one of the Eating Disorders. Use the Research Analysis to complete this assignment. Prepare a 1,200- to 1,700-word paper that discusses research-based interventions to treat the ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

The main providers of health services are health care

The main providers of health services are health care organizations. To enhance efficiency and cost-effectiveness, health care organizations have combined health care sectors or components to create health systems. These ...

Discussion metatheories of childrearingconsider the

Discussion: Metatheories of Childrearing Consider the following two quotes by infant/toddler expert Ronald Lally: "Every single adult, whether conscious of it or not, has an overarching theory that drives his or her chil ...

Question for this assignment you are to examine a topic of

Question: For this assignment you are to examine a topic of lifespan development connecting research and life. Below is a list of topics from which you are to select one for the Outline of the Final Paper and the Final P ...

Question imagine that you are the director of the hr

Question: Imagine that you are the Director of the HR Department at your current organization or an organization with which you are familiar. You are responsible for delegating duties to your team for the selection, deve ...

Discussion - reseaerching careers and exploring through

Discussion - Reseaerching Careers and Exploring Through Experience Part 1: Read and Complete the Exercises for the following chapters Chapter 3: Researching Careers - Changing the Nature of Work - pages 63-96. Chapter 4: ...

Assignment 1 human sexuality throughout history

Assignment 1: Human Sexuality Throughout History Time-line Our readings describe the various historical-cultural influences that have affected human sexuality. These historical-cultural influences include such events as ...

Question leadership case study there are three case studies

Question: Leadership Case Study: There are three case studies located in Appendix A of your book (Pg 441- 445) under the Donald Bradshaw section. Choose one of the three case studies, read the leadership challenge and ho ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As