Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Select one among the following groups from Chapter 1 ( Burkholder, D. M., & Nash, N. B. (2013). Special populations in health care

[Electronic version]):

Vulnerable mothers and children

Abused individuals

Chronically ill and disabled people

People diagnosed with HIV/AIDS

People diagnosed with mental conditions

Suicide- and homicide-liable people

People affected by alcohol and substance abuse

Indigent and homeless people

Immigrants and refugees

Groups for special consideration (you may propose a different vulnerable population at the consent of the instructor)

Once you have selected a group of interest, write a three page paper that covers the following:

Discuss the impact that at least two of the factors below have on the vulnerability of your chosen group:

Age

Gender

Culture/Ethnicity

Income

Analyze the intersection of social, political, and economic factors affecting vulnerability (must address all three factors).

Draft the design of a new model program, not currently existent within your community. Provide a two- to- three paragraph statement that introduces your proposed community program. This section is tentative and might change as you conduct more research. At a minimum, however, items to address should include:

An explanation of the issues and risk factors experienced by the selected population.

An evaluation of the health needs of the group and a proposed continuum of care level (preventive, treatment, or long-term care) based on the group's issues, risk factors, and needs. Justify the proposed level with supportive research/evidence.

A description of one to two proposed services your program will include.

Your assignment should be a minimum of three pages in length (excluding title and reference pages), and should include a minimum of three scholarly sources cited according to APA guidelines.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92479363
  • Price:- $65

Priced at Now at $65, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Assignmentwrite a 500-1000 word essay addressing each of

Assignment Write a 500-1000 word essay addressing each of the following questions. Be sure to completely answer all the questions. Separate each section in your paper with a clear heading that allows your professor to kn ...

Software engineering methodologies assignment - formal

Software Engineering Methodologies Assignment - Formal System Specification Overview - The purpose of this assessment is to provide students with the opportunity to apply knowledge and skills developed during the semeste ...

Question supervisiontravon is the lead counselor in a small

Question: Supervision Travon is the lead counselor in a small clinic. Elliot has worked there for a few years and reports to Travon. Travon completes Elliot's yearly evaluation and oversees his work. Although Travon is t ...

Questions read each question and select the correct answer1

Questions: Read each question and select the correct answer. 1. Susie has never felt comfortable with her therapist. While she has no reason for her feelings, she is easily angered by his questions and feels as though he ...

Theme 1please answer all questions in one threadhipaa

Theme 1 PLEASE ANSWER ALL QUESTIONS IN ONE THREAD HIPAA training: Go to "hhs gov" All students are required to take the following Medscape training programs which are free (but require registration). These videos and tra ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question screening and assessment instrumentsscreening

Question: Screening and Assessment Instruments Screening efforts for any health care problem can be undertaken at various levels. They can be applied routinely to everyone, or they can be targeted, administered only to t ...

Question there can be roadblocks when building trust and

Question: There can be roadblocks when building trust and rapport with clients. However, providing empathetic responses, can help build the trust and rapport needed. When a good relationship is built, clients often feel ...

Mine power supply and drainagemine drainage design taskif

Mine Power Supply and Drainage Mine Drainage Design Task If required it may be assumed that g = 9.81 m/s 2 , Density of water = 1000 kg/m 3 , You are a mine planning engineer at a medium sized operation producing 1.5 mtp ...

Topic 1 choose any song you wish contemporary is fine using

Topic 1: Choose any song you wish (contemporary is fine). Using AT LEAST one verse and the refrain, discuss the lyrics in terms of poetry. Be SURE to discuss the following: content (story), including poetic components su ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As