Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

RESEARCH PROJECT INSTRUCTIONS

The Purpose: There are a couple purposes for this project. The first purpose is to assist you in gaining information and resources on the major issues women may bring to you in counseling. Every student in this class will select a different topic to research.

At the end of this course, this will become a class project in which each student will share his/her research with the rest of the class. This will allow you to compile a resource notebook or a resource file on counseling women. The second purpose is to prepare a presentation for a future workshop you may teach on your selected topic.

Basic Description: You are to select a topic that is of specific interest to you and then research your topic as if you were preparing a workshop on it to teach to a group of fellow counselors.

The topic list provided purposely does not include topics that are discussed in this class. The reason is to help you gain "additional" information beyond what we cover in the class lectures and activities.

You are allowed to seek approval of other topics you would like to present that are not on this list. Before beginning your research, be sure the topic is not covered already in this course and that you have received your instructor's approval.

Instructions for the Research Project:

• Select a topic and submit it to your instructor for approval in the Research Project Topic Discussion Board forum by 11:59 p.m. (ET) on Sunday of Module/Week 1.

• Part A of this project includes the primary research information you would prepare in order to put together a presentation on your topic. It will basically look like a research paper using subheadings to be used in presenting your topic. Part A is due by 11:59 p.m. (ET) on Sunday of Module/Week 6.

• Part B of this project will be a quick outline document that you would provide as a handout at your workshop. This handout can also include additional charts or appendices with an explanation. Submit the Research Project: Part B via the assignment link and also upload this assignment to the Research Project File Exchange under the My Groups tab by 11:59 p.m. (ET) on Sunday of Module/Week 7.

Part A:

1. Select one topic from the topic list provided. Decide on a topic for your research project and post it in the Research Project Topic Discussion Board forum in order to receive approval from your instructor. Each student will research a different topic; therefore, once a topic has been selected, it will no longer be available. Topics will be approved on a "first come, first served" basis.

2. Research your topic by looking for information on treatment options or intervention approaches to assist women with that particular problem/disorder. Investigate your topic in depth; do not provide a broad survey of the topic.

3. Part A of the project should be 12-15 pages in content length. (The abstract, appendices and reference list are not included as content.)

4. The entire paper should follow APA format.

5. You must research at least 12-15 "professional" resources for your topic. A majority (about 80%) of these resources need to be scholarly books, professional journal articles, or professional online websites with no more than 3-4 from professional websites. A combination of all three resources will earn you a better grade. Also, a majority (about 90%) of your resources must be published within the last 10 years.

6. You must include biblical integration as part of your treatment options.

7. Your paper must demonstrate your ability to integrate and synthesize the information you collect in your research. You should not cut and paste information from your sources. If you would like to include lists (example: symptoms, causes, etc.) for any reason, put them in an appendix and refer to them in your paper.

8. As you conduct your research, you may want to look for the following information, however, your primary focus must be on treatment options or interventions:

a. Description of the problem

Summarize the problem by providing a brief description of it.

b. Current statistics on the topic area

Provide any statistics you find in your research that discusses the prevalence or demographics of the problem. (Example: One in four women experience sexual abuse as a child.)

c. Symptoms of the problem

Provide a description of the most common symptoms experienced by someone with this problem. Also, include areas a counselor would want to specifically assess in the initial interview based on what you know about this issue.

d. Causes of the problem

Provide a summary of the general causes that lead someone to develop this type of problem. Include developmental and familial issues in this section.

e. Treatment of the problem - This is the major part, about 50-60%, of your paper.

Provide treatment options that you find in your research. You should use more than 2-3 resources in this section.

f. Biblical perspectives on the problem

Provide verses or biblical examples that you can use to assist someone with this problem.

g. Homework assignments

Provide suggestions for homework assignments found in your research to assist a client in dealing with this problem. If you do not find any in your research, then make a few suggestions using your own creativity.

h. Additional information (optional)

If you find anything in addition that you believe would be helpful to your classmates, please include it here. You may include advice or recommendations from your own personal experiences with this problem (whether you experienced it yourself or assisted someone with the problem).

When putting Part A of the project together, you should include the following:

a) Title Page

b) Abstract

c) Content (12-15 pages)

d) Appendices (additional information)

e) References page

f) If you have a personal illustration that you believe would be helpful to incorporate into your project, please include it in an appendix.

9. When you have completed Part A of the Research Project, submit your draft via SafeAssign. The final copy is due by 11:59 p.m. (ET) on Sunday of Module/Week 6.

Part B:

This part of your project will be a 2-5 page handout that you would provide at your workshop. (This could possibly be converted into a PowerPoint presentation for your workshop).

This handout can also include additional charts or appendices with an explanation for each. This is the part of your project that you will upload to the Research Project File Exchange under My Groups so that you can share with your fellow classmates; do your best to include the important points from your research.

Since this is a handout, feel free to be creative in your arrangement of this handout. You may include pictures, charts, diagrams, etc. You may use different font sizes for your words.

Do whatever is needed to make it an aesthetically pleasing presentation for your audience; however, you must include citations (in APA format) throughout the handout where you include information from your research. At least 5 sources must be used in this handout. (Your audience will want to know where you obtained your information.)

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92407377

Have any Question?


Related Questions in Homework Help/Study Tips

Question 1 dq the federal minimum wage is 725 per hour

Question #1: D.Q: The Federal minimum wage is $7.25 per hour (that's $13,920 a year without taxes). In California, the minimum wage is $11.00 ( $21,120 annually without taxes). According to the U.S. Census, a family of f ...

Question dudley 2009 points out that social work practice

Question: Dudley (2009) points out that social work practice is usually embedded in programs. While you looked at practice evaluation using single-subject design in Week 3, this week, you shift focus to program evaluatio ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Online activity restaurant inspections in other

Online Activity Restaurant Inspections in Other States Length: Approximately2 pages (single space, 12 font size)- Not more than 3 pages Note: You can refer to the Oct 8 ppt file (titled restaurant inspection system in ot ...

Question read through the first page of the document on

Question: Read through the first page of the document on transitions here: Transitions Then follow the directions below: 1. Review your first draft of essay one and complete the exercise suggested in the document: " Tips ...

Directionsanswerthefollowingquestioninyourownnbspwordsplease

Directions: Answer the following question "IN YOUR OWN  WORDS". Please make sure each question is answered  thoroughly and complete. Place the answer under the number  you are answering. 1. Explain the differences betwee ...

It is true we all probably have personal stories of how

It is true, we all probably have personal stories of how people grew up a certain way, and then later in adolescence or adulthood it as difficult to change those ways of thinking or acting. Does their learning style then ...

Course-level student learning outcomes slofor all

Course-Level Student Learning Outcomes (SLO) For all Assessments, the following general requirements hold: (1) Assignments should be 2-3 double-spaced pages, with reasonable (12 pt.) font and reasonable (1 inch) margins. ...

Explain what you do or will do to satisfy this

Explain what you do or will do to satisfy this competency. The statement should demonstrate your ability to meet the specific needs of this area. it should be written in the first person and use your own words. Use parag ...

Discussion the features and scope of crisesyou likely have

Discussion : The Features and Scope of Crises You likely have some preconceived notions about what a crisis entails. Perhaps the word crisis immediately evokes the idea of a natural disaster, such as a hurricane or a tsu ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As