Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Religion in America

1) Write a 150-300 word summary analysis for Each of your two selected National Religion databases. The analysis should cover the type of data on the site, an example of statistical data from the site, and a statement of how the database will be useful in the study of the sociology of religion.

RELEVANTWORLDWIDEWEBSITES

You have chosen:

The Hartford Institute for Religion Research at the Hartford Seminary: This site covers research in areas such as women and religion, church growth and decline,religion and the family, religion, and the Web, plus more.

Churches for Middle East Peace

Interfaith Sexual Trauma Institute

Ontario Consultants on Religious Tolerance page on religious violence

The Pew Forum on Religion in Public Life

The purpose of the assignment is to develop the skill to access and use National Religion Databases. You will analyze various databases and will use your findings in this assignment as a tool for other assignments in this course.

Assignment Description: The assignment is to do a computer search of National Religion Databases. Discover and list four database sites and then select two that you will review.

Steps to Follow:

1) Read the section at the end of each chapter of your textbook, RELEVANT WORLD WIDE WEB SITES and/or perform an internet search for other national religion databases.

2) After reviewing a number of websites such as www.aarweb.org or the Pew foundation website, list four of the national religion database websites you investigated. You do not need to provide a parenthetical citation for each website. Just listing them is sufficient.

3) Select two websites from your list above and analyze them.

4) Write a 150-300 word summary analysis for each of your two selected National Religion databases. The analysis should cover the type of data on the site, an example of statistical data from the site, and a statement of how the database will be useful in the study of the sociology of religion.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92590412
  • Price:- $20

Priced at Now at $20, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Health care system comparisoncompare the us system of

Health Care System Comparison Compare the U.S. system of healthcare to one in another country of your choosing. List at least three key differences in the health care system of your country of choosing as it relates to t ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question jim is offered an investment opportunity with the

Question: Jim is offered an investment opportunity with the "guar-antee" that his investment will quadruple in 12 years. Assuming quarterly compounding, what is the nominal interest rate Jim is getting on this investment ...

Assignmentyou have been allocated a cdna accession number

Assignment You have been allocated a cDNA accession number from the NCBI database (see table below on page 2). Your task is to design experimental strategies that will allow you to: clone the cDNA in different expression ...

Energy management assignment -the company asked you to

ENERGY MANAGEMENT ASSIGNMENT - The company asked you to determine what the energy management opportunities are and what the impact and costs will be if these options were implemented. There are various options that can b ...

Tasksyou are required to analyse the performance of the

Tasks You are required to analyse the performance of the steam cycle, and comment on the feasibility of converting to alternative fuel sources. Making suitable approximations where required, and referencing sources of ad ...

Quesiton social workers must be refined observers when

Quesiton: Social Workers must be refined observers when interaction with clients. It is a skill that we must develop. This assignment requires each student to conduct an observation of the child (Infant to 11 year old). ...

Question our group is going to organize and hold a ball

Question: Our group is going to organize and hold a ball game in las vegas. there are ten aspects with regard to the game. and i'm in charge of the No.8 task. Write down your ideas of how to solve this problem. 1. Select ...

Question 1why has innocent drinks succeeded2what specific

Question: 1. Why has Innocent Drinks succeeded? 2. What specific resources/activities/attributes did the company build or conduct to take advantage of the opportunities in the market? At what cost were these resources/ac ...

Primary task response within the discussion board area

Primary Task Response: Within the Discussion Board area, write 400-600 words that respond to the following questions with your thoughts, ideas, and comments. This will be the foundation for future discussions by your cla ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As