Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Refer to the University of Phoenix Material: Professional Interview and Response Guidelines for assignment guidelines.

Interview two helping service professionals from two different settings, such as a school, hospital, or prison. Ensure that at least one of the interviewees is a clinical psychologist.

Provide the name and work environment of the two professionals you interviewed.

Ask the following questions to each of your interviewees:

In what setting do you practice? How long have you been practicing?

What are your specialties or areas of clinical focus?

What are the most common disorders you treat?

Do you have any special certifications or training beyond your original graduate coursework?

How do you approach therapy or treatment? Do you use specific modalities, techniques, or interventions?

What ethical and legal issues do you think are the most challenging or common?

Do you have an opinion on where you think the field of psychology is heading?

What do you enjoy most about your work?

What advice would you provide an aspiring psychologist or therapist?

Discuss, in a 350- to 700-word response, the similarities and differences of how these professionals approach treatment in their settings.

Format your paper consistent with APA guidelines.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91872750
  • Price:- $50

Priced at Now at $50, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Assignment leadership styles in the workplace at home and

Assignment : Leadership Styles in the Workplace at Home and Abroad In this module, you examined four primary leadership theories along with the emerging discursive approach. Along the way, you learned about communication ...

Question why do you think informed consent is necessary in

Question: Why do you think informed consent is necessary in our modern society? In your opinion, if we remove the liability (right to sue) for lack of informed consent, will that enable doctors to provide better and fast ...

Question given the various predisposing factors that make

Question: Given the various predisposing factors that make humans susceptible to opportunistic infections, how can healthcare providers curtail the rising incidence of such infections? (8 sentences) The response must be ...

Question using the directional terms in the table from your

Question: Using the directional terms in the table from your textbook, describe how you, or someone close by you, is sitting or standing. Include at least 5 of the terms describing body positioning and movement. Then des ...

Question read the article titled securing the cloud for the

Question: Read the article titled "Securing the Cloud for the Enterprise". What do YOU believe to be the two (2) most important security considerations related to cloud deployments, and explain the main reasons why you b ...

Module after completing this discussion you will be able to

Module After completing this discussion, you will be able to distill what you learned in completing your Special Topic Paper and share it with other students, as well as react to what others learned. Share your topic wit ...

Question please do an internet search and find out the

Question: Please do an internet search and find out the results of the Erin Andrews invasion of privacy case that the Craig discusses in the assigned text. Write a commentary on your thoughts on the case. Need 300-350 wo ...

Question describe what makes andy resilient how does he

Question: Describe what makes Andy resilient. How does he incorporate control and his sense of self? Compare Andy's approach to Red and Brooks' ways of dealing with being incarcerated. Part II: What impression did this m ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Assignment discussion questionworking in teams leads to

Assignment: Discussion Question Working in teams leads to complex interpersonal problems. Do you think working in teams is worth the effort to manage through work place problems and find viable solutions? Are there effec ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As