Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

TASK:

Wanda is a 16-year-old African-American who lives in an economically disadvantaged neighborhood. She lives with her mother and five siblings. Wanda and another girl, also of a minority group, were taken into custody by the police for fighting.

Discuss the social characteristics that Wanda may have in common with other juvenile offenders and describe how these social characteristics may or may not impact her likelihood of involvement with the juvenile justice system. In your discussion, try to delve past statistical categories and look more closely at the factors that might impact this demographical information.

Use the Library to research and examine different aspects of juvenile offender characteristics.

OBJECTIVE

- Recognize the theories of juvenile delinquency and how they relate to the concept of juvenile crime.

- Summarize the social characteristics of juvenile court system and accompanying laws.

Can you include reference list and a couple intext citations?

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M930737

Have any Question?


Related Questions in Homework Help/Study Tips

Question describe how the concepts of leadership and

Question: Describe how the concepts of leadership and management differ from each other. In what areas do they overlap? Explain how the goals of management and leadership may sometimes overlap. As a nurse leader, do you ...

Where does race and ethnicity racial barriers and wealth

Where does race and ethnicity, racial barriers and wealth fall in place in the racial wealth gap ? Please give examples.

Assignment acts of terrorism are intended to have an impact

Assignment: Acts of terrorism are intended to have an impact far beyond the death and destruction of the immediate attack. Mass fear and interruptions to normal daily functioning occur in the aftermath of terrorist attac ...

Write a short essay or paragraph of at least 300 wordswhich

Write a short essay or paragraph of at least 300 words. Which supervision conditions are pertinent to these sex offenders? Which additional conditions should be imposed on the offender in terms of his or her offense, and ...

Question describe a public space that you had visited i

Question: Describe a public space that you had visited ( i would prefer you write about Starbucks or Walgreen and walmart etc..) describe that space, and explain why you think the designers included the particular design ...

Question statistical tests and provide a real-world example

Question: Statistical tests and provide a real-world example in which it is applicable. Explain why the test is appropriate for the example. Factual Test Conclude why reporting results with a margin of error is more info ...

Question the presentation was a success and the cio of the

Question: The presentation was a success, and the CIO of the organization you chose, while pleased, has another task for you. Because of the overwhelming support he gained from your presentation, he is assigned with staf ...

Environmental geoscience - geoscience in the news

Environmental Geoscience - "Geoscience in the News" Presentation Assignment This assignment will give you experience applying course content material to a specific and current real-life example. Instructions - A. Select ...

What is the connection between perceiving and moving

What is the connection between perceiving and moving through the environment?

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As