Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Reciprocal Teaching

As stated in Chapter 6 of our text, reciprocal teaching is an instructional approach for teaching students cognitive strategies to improve reading comprehension. This model of teaching is based heavily on the social learning theories of Lev Vygotsky and Albert Bandura who emphasize the importance of teacher-student interactions in the learning process. One of the Common Core English Language Arts College and Career Readiness Anchor Standards for Reading states the following:

"Read closely to determine what the text says explicitly and to make logical inferences from it; cite specific textual evidence when writing or speaking to support conclusions drawn from the text."

For this discussion:

Read the Closing in on close reading article about this idea of "close reading" as part of the CCSS initiative. http://www.ascd.org/publications/educational-leadership/dec12/vol70/num04/Closing-in-on-Close-Reading.aspx

Watch the video Watch & learn: text comprehension and discuss how the students assume responsibility for helping one another learn. https://www.youtube.com/watch?v=rbnwBVrJVdY

Finally, explain how reciprocal teaching helps students comprehend what they read more deeply and how it also reflects this idea of "close reading" as described by the Common Core Standard. Which educational psychology theory or theories does reciprocal teaching employ?

Please be as descriptive and detailed :)

Book: LeFrançois, G. (2011). Psychology for teaching (11th ed.). San Diego, CA: Bridgepoint Education, Inc.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91957561
  • Price:- $20

Priced at Now at $20, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question to prepare for this discussion please read chapter

Question: To prepare for this discussion, please read Chapter 9 of your textbook. In addition, complete the International Personality Item Pool Representation of the NEO PI-RTM, watch Correlation: Against All Odds: Insid ...

Course projectlast week you completed the literature review

Course Project Last week, you completed the Literature Review section of your paper. This week, you will complete the Description of the Program section of your paper, and then submit the work that you have completed to ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Critical thinking process by shawnesty maysunderstanding

Critical Thinking Process by Shawnesty Mays. Understanding Turnitin As you have progressed through this course, you have learned the importance of developing your scholarly voice, you have learned about critical thinking ...

Case study profits amp food safetythe case of bmijose

Case Study : PROFITS & FOOD SAFETY THE CASE OF BMI Jose works as a clerk at the headquarters of Best Meat International, LLC (BMI), a US-based food processing company. With a history of over 60 years, the company has est ...

Answer one of the following questions1 explain talcott

Answer one of the following questions: 1. Explain Talcott Parsons' main arguments his essay, "Sex Roles in the American Kinship System" and how they relate to key ideas within structural functionalism (as described by Jo ...

This assignment requires to write on automation which must

This Assignment requires to write on automation which MUST cover all the following points - The benefits, drawbacks, risks and opportunities of automation in general. Assignment 2 Part 2 Analyzing and Designing To-Be Bus ...

Influence of economics on household decision makingpurpose

Influence of Economics on Household Decision Making Purpose of Assignment To locate, retrieve, and evaluate the effects of macroeconomic indicators on your own decision making. Assignment Steps Resources: Tutorial help o ...

Assignmentin this assignment you will be creating an essay

Assignment In this assignment, you will be creating an essay on "Describe contemporary policing trends and issues that law enforcement is facing". Your essay will follow the academic 5-paragraph format: Introduction para ...

Question provide information and discuss the following

Question: Provide information and discuss the following topics: 1. An introduction of yourself (your work, hobby, interests ...). 2. Why IT is important to your career? What do you want to get by studying this subject? W ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As