Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Read the following situation: The local textile plant has a workforce of 55 full-time hourly workers, 12 part-time workers (less than 15 hours per week), and six managers that are salaried. The company has been struggling for about five years and has just lost its only major account with a sporting clothes company. Contract renegotiations have been intense for the past six months, but they collapsed two days ago. There is barely enough cash to pay workers for their last two weeks of work. In order not to incur additional payroll obligations to the workers, the company has called a meeting of all employees to announce the plant's closing at the end of the week (in two days). Although the workers were not overly surprised, they were overwhelmed that so many would be seeking employment in their small community within the next few days. Even though the hourly workers are to be terminated at the end of the week (in two days), managers (those that are salaried) will receive their pay for another 60 days as they handle the closing of the plant.

Analyze this situation from the perspective of the company managers and the HR department by addressing the questions below. Before beginning your analysis, read Section 639.9 "When may notice be given less than 60 days in advance" of the Worker Adjustment and Retraining Notification (WARN) Act. Click here to access the WARN Act.

Answer the following questions in your report: Do you agree with management's human resource plan of action for the immediate plant closing?

Why or why not? Explain in detail and include the legal implications. What does the WARN Act say that allows the plant to close inside of the 60-day notice period?

What possible alternatives do the managers and HR have in handling this scenario? If no other attractive options exist and they must depart in two days, what kinds of assistance can the plant give the newly unemployed workers? Given the financial restrictions, is outplacement assistance a possibility?

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91944876

Have any Question?


Related Questions in Homework Help/Study Tips

Question theory and educationcollapseplease review the

Question: Theory and EducationCOLLAPSE Please review the McEwen and Wills (2014) chapter 21: Theoretical Issues in Nursing Curricula and Nursing Instruction and complete the following steps for your initial discussion po ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Assignment -1 read the full sarbanes-oxley act 200

Assignment - 1) Read the full Sarbanes-Oxley Act. (200 words) Submit a short paper (2-3 paragraphs): a) What is that doc about? b) What did you learn from it? c) Why is it important? 2) Optional task (300 words) Watch Mo ...

Assignmentimagine you have the opportunity to pitch an idea

Assignment Imagine you have the opportunity to pitch an idea for a new TV or movie program that is based on current market trends. You will need to research what the popular genres are in either movies or television and ...

What is an abstract paragraph when the topic is achieving

What is an abstract paragraph when the topic is achieving competitive advantage through training?

Discuss the george zimmermantrayvon martin case from a

Discuss the George Zimmerman/Trayvon Martin case from a legal perspective. Please answer the following: What crimes was George Zimmerman been charged with in the death of Trayvon Martin? What defense(s) did he raise? Wha ...

Assignment detailsto better understand a treaty one might

Assignment Details To better understand a treaty, one might look at it as a contract. There must be parties willing to enter into an agreement. An offer is made by one or a group of parties and is accepted by another par ...

Read the scenarios and then provide a short analysis based

Read the scenarios and then provide a short analysis based on the questions that follow. Miranda A uniformed police officer is dispatched to a bank robbery. Upon arrival, John Smith is already under arrest by the detecti ...

What is sensory processing disorder describe and discuss

What is sensory processing disorder? Describe and discuss the symptoms. How does this relate to autism?

Question psychologists have discovered that human beings

Question: Psychologists have discovered that human beings experience several different states of consciousness during the course of a day. For example, people have times when they are especially alert and times when they ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As