Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Question:

You have been approached to design the label for a 3-piece can. The following information is provided to you to complete the artwork:

The company name: Food Mart
Product line name: My friend Veggie
The product: cooked carrot
Target audience: young children

(a) List five compulsory elements you will include in the canned food label.

(b) Identify different parts of a 3-piece can. Illustrate your answer.

(c) Design the layout of the label you would propose to your client.

(d) Propose a surface design for the front section of the label communicating effectively to the target audience. Illustrate your answer.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M9589194

Have any Question?


Related Questions in Homework Help/Study Tips

Library and internet research exercise -read the following

Library and Internet Research Exercise - Read the following two selections. Note five main ideas in each article, then re-write the main ideas using your own words, following the examples above. 1. Edelman, Marian Wright ...

Question lesson 3 discussion forumdesigning team and team

Question: Lesson 3 Discussion Forum Designing Team and Team Identity Part 1: Think about how to build teams in terms of designing the task, selecting the people, and then, managing their relationships. How would compose ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question i understanding the flow of negotiations

Question: I. Understanding the Flow of Negotiations: Stages and Phases A. The typical steps or flow in a negotiation can be found in the phase models of negotiation: 1. Initiation. 2. Problem solving. 3. Resolution. Defi ...

1 how are basics of defense and the levels of security

1. How are basics of defense and the levels of security related? 2. What perimeter and building controls (interior and exterior) are usually implemented? 3. How are human protection systems, alarm systems, and fire prote ...

Question for this group discussion forum consider the

Question: For this group discussion forum, consider the application of performance metrics in all types of industries (manufacturing, service, education, healthcare, government, etc.). Using either your personal experien ...

Question the ames riders a womens professional basketball

Question: The Ames Riders, a women's professional basketball team, employs a head coach and two assistant coaches. The total number of employees of the team (including players) is 20. The head coach, a male, is known for ...

Question what types of stressors increase the likelihood of

Question: What types of stressors increase the likelihood of adjustment disorders? What factors increase the risk of developing an adjustment disorder? How are adjustment disorders different from more chronic conditions? ...

A researcher is looking at the foot-in-the-door phenomenon

A researcher is looking at the foot-in-the-door phenomenon (in which asking somebody to a small task increases their willingness to a larger task later) and door-in-the-face phenomenon (where asking for something big fir ...

The final project for this course will allow you to see

The final project for this course will allow you to see yourself in a range of criminal justice practitioner roles. Each position will require you to address different issues and concerns indicative of that area of crimi ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As