Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Question: Using the Gift of Fire Text Book answer the following questions. They must be answered in your own words with your own interpretation and not plagiarized. Each question must be labeled and stated verbatim. Your responses to each of the four questions must be a minimum of 200 words, per question. All responses must be thoughtful and cannot be plagiarized. Additionally, I expect APA formatted in-text citations as well as references.

1. a. Give two examples of job categories for which the increased productivity of computer systems strongly reduced the number of people working in those areas.

b. Give an example of an area in which computer technology reduces jobs for skilled workers. Give an example of how computer technology enables people with less skill and/or training to do jobs that used to require more. Explain how computer technology changed the skill level required for these jobs.

c. Give two examples of jobs that did not exist before the Internet.

2. Explain the ethical and social implications of "offshoring". Consider the issue from the perspective of both U.S. employees and foreign employees. Consider the issue from the perspective of companies hiring foreign workers.

3. Give three Neo-Luddite criticisms of technology? Provide one counter-argument for each.

4. a. What are the three questions one should ask when evaluating a computer model?

b. What might cause a computer model to inaccurately reflect a real-world scenario?

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92780928
  • Price:- $40

Priced at Now at $40, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Self-analysis amp reflectionthe key aspect of reflection is

Self-Analysis & Reflection. The key aspect of reflection is a critical evaluation of the self. Students will undertake a number of in-class cases during the semester and must use two (2) of the nominated cases as the bas ...

Within the discussion board area write 400-600 words that

Within the Discussion Board area, write 400-600 words that respond to the following questions with your thoughts, ideas, and comments. This will be the foundation for future discussions by your classmates. Be substantive ...

Question prompt dayer-berenson ch 31 as we conclude this

Question: Prompt: Dayer-Berenson, Ch. 3 1. As we conclude this course, can you define the primary and secondary characteristics of your own culture? Can you describe the characteristics of you race and your ethnicity?

Question write an argumentative paper on works rightvs

Question: Write an argumentative paper on work"s rightvs. Human Rights. This assignment asks students to articulate and debates the differences between workers' rights. How are the two concepts different, and what are th ...

Discussion bullpredict two 2 external and or internal

Discussion : • Predict two (2) external and / or internal challenges facing today's medical group practice administrators. Compose a strategy to manage the challenges in question. Justify your response. • Imagine that yo ...

Assignment 1 discussion questionby the due date assigned

Assignment 1: Discussion Question By the due date assigned, respond to the discussion question. Submit your response to the appropriate Discussion Area. Use the same Discussion Area to comment on your classmates' submiss ...

Objectivesthis assessment item relates to the course

Objectives This assessment item relates to the course learning outcomes numbers 2, 3, 5 and 6 as stated in the online course profile. Details For your creative work you are going to design, specify, implement and test a ...

American federalism has been a very effective framework for

American Federalism has been a very effective framework for sustaining our democracy. This overlapping and complementary system of government allows governmental leaders at all levels to develop their own political, soci ...

Question identify a topic for research paper and submit an

Question: Identify a topic for research paper and submit an outline to the instructor. The paper should address a strategic business decision using relevant economic factors. The paper should be 10-12 pages long, with ma ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As