(Answered) Question using the course software create the first page

Others

Question: Using the course software, create the first page (home/index page) for your website that demonstrates effective application of design elements based on your website plan.

Include the following:

• A single page named index.html

• Effective use of color, images and font

• Proper page markup language

Save your website page as index.html.

Validate your HTML code using the Markup Validation Service on the W3C® website, prior to submitting your web page(s).

Note: Your website does not need to be fully functional (for example, links may not work yet), but it should open up in a browser and include all design elements. Incomplete portions of the page should include text to indicate what is planned for that area.

Submit your compressed (zipped) files to the Assignment Files tab.

View complete question

Homework Help/Study Tips, Others

Category:- Homework Help/Study Tips
Reference No.:- M93082971
Price:- $20

Verified Expert

Priced at $40 Now at $20, Verified Solution

Have any Question?Write your Review or question?

Related Questions in Homework Help/Study Tips

Question body weight regulation and anorexiaaccording to

Question: Body Weight Regulation and Anorexia According to data by the U.S. Centers for Disease Control, the United States has seen a dramatic increase in obesity with all states having 20% or more of their population be ...

What are some strategies used to foster both motor and

What are some strategies used to foster both motor and sensory development?

Chapter threecomplete parts one to three belowpart one1 why

Chapter Three Complete parts one to three below: Part one: 1. Why is privilege called an invisible obstacle? 2. If a person has racial privilege, gender privilege, religious privilege, socioeconomic privilege, ability pr ...

Big data and analytics assignment - analytic report and

Big Data and Analytics Assignment - ANALYTIC REPORT and PRESENTATION Analytic Report Purpose: The purpose of this task is to provide students with practical experience in working in teams to write a Data Analytical repor ...

Assignment affirmative actionaffirmative action is a

Assignment : Affirmative Action Affirmative Action is a controversial topic in American society. People of all races, genders, and classes are divided on where they stand on Affirmative Action. However, the media has ove ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

For this scholarly activity you are going to create a chart

For this scholarly activity, you are going to create a chart with the following columns: 1. Males, 2. Females, 3. Common Traits, and 4. Differences. Your job is to list the common aspects of the male or female prison sub ...

Quesiton you have been called in to consult on cases that

Quesiton: You have been called in to consult on cases that may require mandated treatment. After reviewing the PSY699 The ethics of mandated treatment scenarios, choose two to discuss in your initial post. Begin your res ...

Question select a practice problem of interest to use as

Question: Select a practice problem of interest to use as the focus of your research. Start with the patient and identify the clinical problems or issues that arise from clinical care. Following the PICOT format, write a ...

Question cultural development exerciserequirements - this

Question: Cultural Development Exercise Requirements: - This is a 3-5 page paper. (You will need to answer all questions fully). - You should have a MINIMUM of three sources for this paper. (You may use the videos we wat ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Homework Help/Study Tips Expert