Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Question: The text states that the most important question in public administration is how to give administrators enough power to accomplish the work that policymakers want done, without having them exercise that power in a way that threatens democracy and liberty. In essence, effectiveness exists alongside of accountability and, according to the text; accountability becomes a matter of "balancing internal norms with external processes." The way this is done is through a combination of "independence" and "redundancy." Is this the best way to keep government systems accountable?

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92721297

Have any Question?


Related Questions in Homework Help/Study Tips

What are the characteristics of the ideal parents how does

What are the characteristics of the ideal parents? How does parenting style change as a child develops?

Question final paperthe purpose of the final project paper

Question: Final Paper The purpose of the Final Project Paper is for you to culminate the learning achieved in the course by describing your understanding and application of knowledge in the field of Organizational Behavi ...

Question confidentialitya counselor has been treating a

Question: Confidentiality A counselor has been treating a client, Jay, who was recently in a bad accident that left him bedridden and partially paralyzed. With sustained physiotherapy and medication, the paralytic effect ...

Question being culturally sensitive by respecting your

Question: Being culturally sensitive by respecting your clients' spirituality and religious traditions, in general, is an important professional competence (Furness & Gilligan, 2010). Applying your spiritual awareness to ...

Questions read each question and select the correct answer1

Questions: Read each question and select the correct answer. 1. Susie has never felt comfortable with her therapist. While she has no reason for her feelings, she is easily angered by his questions and feels as though he ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question 1 find a research idea 3 topics select a topic and

Question: 1. Find a research idea (3 topics), select a topic and search the literature to find an unanswered question. 2. Form a hypothesis. 3. Determine how you will define and measure your variables. 4. Identify the pa ...

Question no 1 - american jurisprudence 2dyour law firm has

QUESTION NO. 1 - AMERICAN JURISPRUDENCE 2d: Your law firm has been retained to defend Mrs. Dolores Assaulted. Her husband had routinely beaten her. He beat her when he was angry; he beat her when he thought that she did ...

Question 1 list and explain the four common challenges

Question: 1. List and explain the four common challenges leadership faces. 2. The Employment-at- Will is a doctrine developed as part of British common law which applies to many states in the U.S. List the major exceptio ...

Question servant leaders must be internally consistent with

Question: Servant leaders must be internally consistent with their words and actions. Describe a mentor that you have had that displayed this kind of credibility. Share an example of what you witnessed from this person. ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As