Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Question: SWOT analysis (alternatively SWOT matrix) is an acronym for strengths, weaknesses, opportunities, and threats and is a structured planning method that evaluates those four elements of an organization, project or business venture. A SWOT analysis can be carried out for a company, product, place, industry, or person. It involves specifying the objective of the business venture or project and identifying the internal and external factors that are favorable and unfavorable to achieve that objective. Some authors credit SWOT to Albert Humphrey, who led a convention at the Stanford Research Institute (now SRI International) in the 1960s and 1970s using data from Fortune 500 companies.However, Humphrey himself did not claim the creation of SWOT, and the origins remain obscure. The degree to which the internal environment of the firm matches with the external environment is expressed by the concept of strategic fit.

Strengths: characteristics of the business or project that give it an advantage over others Weaknesses: characteristics of the business that place the business or project at a disadvantage relative to others Opportunities: elements in the environment that the business or project could exploit to its advantage Threats: elements in the environment that could cause trouble for the business or project Identification of SWOTs is important because they can inform later steps in planning to achieve the objective. First, decision-makers should consider whether the objective is attainable, given the SWOTs. If the objective is not attainable, they must select a different objective and repeat the process. Users of SWOT analysis must ask and answer questions that generate meaningful information for each category (strengths, weaknesses, opportunities, and threats) to make the analysis useful and find their competitive advantage.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92719712

Have any Question?


Related Questions in Homework Help/Study Tips

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question review paper-topic proposal amp reference pagethe

Question: Review Paper-Topic Proposal & Reference Page The purpose of this assignment is to provide you with the opportunity to select a topic in the particular area in which you have an occupational or research interest ...

Question 1 many different types of prostitution are listed

Question 1 : Many different types of prostitution are listed in this chapter. Are some types more acceptable than others? Why? (i.e., is the high-status work of a "call girl" more acceptable than the low-status work of a ...

Assignmentdrug seizure laws have come into prominence in

Assignment Drug seizure laws have come into prominence in the United States. When a drug arrest is completed, the law enforcement community may seize property such as a home, a car, or any monies from the criminal enterp ...

Multiple-choice questions -1 the artifacts of the ancient

MULTIPLE-CHOICE QUESTIONS - 1. The artifacts of the ancient Nok people of the Jos Plateau provide archaeological evidence of all of the following EXCEPT a. highly developed iron-making capabilities. b. settled communitie ...

Questions 1 relate the concept of diagnostic coding and

Questions: 1. Relate the concept of Diagnostic Coding and importance in the Medical Field. 2. Differences between Inpatient versus Outpatient Coding and the uses. 3. Characteristics and importance of The Diagnosis CODEBO ...

Questionpseudoarchaeological write-upfind a good example of

Question: Pseudoarchaeological write-up Find a good example of a pseudoarchaeological claim or series of claims we haven't covered in class Provide a brief list of books, publications, or websites/videos detailing this c ...

Question assume that your company is considering the

Question: Assume that your company is considering the replacement of an automated milling machine with one of the new machines offered by three different manufacturers. Each of the three machines under consideration is e ...

Assignment - an ios recipe applicationintroductionin this

Assignment - An iOS Recipe Application Introduction In this assignment, you will create a simple Recipe application for iOS using Xcode (Swift). This application allows users to view food recipes. Read the entire Assignm ...

Explain how surveys address the short comings of

Explain how surveys address the short comings of naturalistic research and case studies?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As