Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Others


Home >> Homework Help/Study Tips

Question: Review each of the items below and check if you have completed each of them:

1. I have selected an approved essay topic from the essay course descriptions page. Link is attached.

2. Some essays have specific experience requirements. I have checked the essay description and I meet all of the experience requirements listed.

3. I have written and included a 1,500 to 2,100 word autobiography; autobiography is only required with first Experiential Learning Essay, subsequent essays do not require additional autobiographies.

4. I have written an experiential essay: 3,000 to 4,500 words for 3 credit essay

5. My essay is written in first person (1st) without references.

6. I have written to all four (4) areas of Kolb's model of learning.

7. I have addressed all of the required subtopics in each of the four areas of Kolb's model of learning.

8. I have included supporting documentation that validates my personal/professional experience with the essay course description/topic.

9. My essay is based on personal, life learning experiences, not based on research, history, or another individual's learning experiences.

Information related to above question is enclosed below:

Attachment:- Sample-Autobiography.rar

Attachment:- Resource.rar

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92746666
  • Price:- $60

Priced at Now at $60, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

You identified a need such as new equipment expanding

You identified a need, such as new equipment, expanding curriculum, change in procedures, and so forth, that you want to address through the instructional curriculum you will create for your class project. You also provi ...

Questionnbsp ralph waldo emerson an important american

Question  Ralph Waldo Emerson, an important American writer and contemporary of the writers in this Module, called for a new kind of uniquely American Literature and a new kind of poet. He wrote: "The poet has a new thou ...

Assignment leadership styles in the workplace at home and

Assignment : Leadership Styles in the Workplace at Home and Abroad In this module, you examined four primary leadership theories along with the emerging discursive approach. Along the way, you learned about communication ...

Policy analysis paperyour assignment is to gain a thorough

Policy Analysis Paper Your assignment is to gain a thorough understanding of the nature and extent of your selected problem. You will (1) describe the problem you have discovered; (2) provide background of the problem (i ...

Assignment 3 biopsychosocial-cultural modeltraditionally

Assignment 3: Biopsychosocial-Cultural Model Traditionally, mental illness was considered a biological problem, either inherited or developed due to genetic vulnerability within the individual. This point of view is term ...

Question big data is everywhere and various businesses

Question: Big Data is everywhere and various businesses around the world are driven by Big Data. However, while some businesses rely on Big Data for organizational decision making, this does not mean that the implication ...

Question nonverbal communication1-describe a scenario in

Question: Nonverbal Communication 1-Describe a scenario in which a person's nonverbal language says something quite different from the same person's verbal language. 2- Public speaking Public speaking is different from c ...

Question diversity training manual part ivas the new

Question: Diversity Training Manual: Part IV As the new manager of human resources, you are preparing the next section of the diversity training manual, which focuses on making supervisors more aware and sensitive to rel ...

What is sensory processing disorder describe and discuss

What is sensory processing disorder? Describe and discuss the symptoms. How does this relate to autism?

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As

Follow Us

© Copyright 2013-14 mywordsolution.com All rights reserved