Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Question: Happy's Hype Energy Drinks will be a non- alcoholic beverage company that will deal with a wide array of flavored mixed energy drinks. In coming up with a company name, it is imperative for the originators to craft a name that the potential clients can easily identify themselves with. The name Happy Hype Energy Drinks is easy to grasp and may be instrumental in selling the company's product portfolio to the public. In addition, the name will not be recanted because it has not been used elsewhere. The name will not attract litigation if used because it has not been registered elsewhere by the registrar of companies as a beverage or an allied company. The name Happy's gives the customer the idea of a pleasurable drink that will make them feel good. The drinks will be brewed from natural ingredients with sheer elegance, perfection and skill in a variety of fruity flavors.
Mission Statement

The mission of the company is to enter into and to continuously operate in the competitive industry and stay in line with best corporate practices and embodies quality and taste for ultimate customer satisfaction.

The mission statement will be streamlined by the company's desire to synchronize the production and distribution of sublime quality energy drinks based on customer preferences and compliance with safety standards. The company in line with its mission will endeavor to facilitate an unhygienic environment in manufacturing of products safe for human consumption with no health issues. ( My Company)

Assignment 1: Company Description and SWOT Analysis

In this assignment, you will conduct a SWOT (Strength, Weakness, Opportunity, and Threat) analysis for the type of beverage you have selected, and for your company overall. As you work on the assignment, consider why you have chosen one type of non-alcoholic beverage over another and the reasons for that choice. As you complete your SWOT analysis, be sure to include external factors such as industry / market trends and competition, and internal factors such as your capabilities or abilities to reach certain market segments.

Write a three to five (3-5) page paper, in which you:

1. Create your revised NAB company name and explain its significance.

2. Develop your revised company's Mission Statement and provide a rationale for its components.

• Hints: Use the Statement of Mission template on pp. 72-73 on the course textbook: Successful Business Plan to aid your development. Extracting appropriate information from the NAB company portfolio, where applicable. You should fill in other required items in the template using your personal preferences.

3. Describe the trends in the non-alcoholic beverage industry, especially the specific type of beverage category you have chosen. Justify at least three (3) reasons why you have chosen this type of non-alcoholic beverage.

• Hints: Research and outline beverage industry trends. Consider the size and growth rate of the industry overall and the specific beverage type you have chosen. Use the worksheet in the course text (p. 88 | Past and Future Growth of Your Industry) to help you project the future growth rate. Consider the use of industry associations and search engines to find reliable, recent data.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92791098
  • Price:- $80

Priced at Now at $80, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Assignment application amp test reportthe briefyour small

Assignment: Application & Test Report The Brief Your small development team of (ideally) three people has been asked to implement and test the Human Resources Information System desktop application. Your software product ...

According to wilma king in what ways were enslaved women

According to Wilma King, in what ways were enslaved women more vulnerable to sexual exploitation? How are Celia and Nelly's crimes acts of resistance

Child backgroundthe child is a 11-year-old caucasian male

Child background: The child is a 11-year-old Caucasian male who lives with his parents. he has5 siblings and they are currently living within the same household. This child has ADHD. His attention problem may relate to h ...

Answer the following question 1 give an example of an

Answer the following Question : 1. Give an example of an innovative compensation or benefits program from within or outside the health care industry. Brief description 2. Evaluate the program selected a. In your opinion, ...

Question rules are specific detailed directives that are

Question: Rules are specific detailed directives that are developed to assist leadership in establishing the parameters which the individuals of the organization must conduct their activities (Longest, 2016). Rule-making ...

When is the appropriate timing to talk with the client

When is the appropriate timing to talk with the client about assessments? Should this be a part of the intake process?

Assignment 2 workplace ethicsoverview this assignment will

Assignment 2: Workplace Ethics Overview: This assignment will give you the opportunity to choose a case study, and then write about the ethical implications and the impact of the events that are described. Each case stud ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question 1the two major cell types that make up the nervous

Question: 1. The two major cell types that make up the nervous system are cells and . 2. Almost all hormone secretion is under the control of the gland, which is in turn controlled by the . 3. The basal ganglia include t ...

Health promotion assignment -learning outcomes - understand

Health Promotion Assignment - Learning Outcomes - Understand the socioeconomic influences on health. Understand models of health promotion. Understand factors which influence health promotion. Be able to plan a health pr ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As