Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Question: For this discussion, find a couple of sources that explain cultural differences. These can be internet websites (this is on time you can use sources such as Wikipedia or other websites). Give an overview of several of the cultural differences you find (different from your own). Then, discuss how these differences may post a challenge for you as you counseling clients of different races, cultures, or other areas of diversity. Include in your discussion some personal struggles you might see, or things you would need to pay particular attention to as you seek to communicate with diverse people in helping relationships. A key to this discussion is to practice good self-assessment as well as and understanding of cultural diversity.

Be sure to identify and cite your sources in APA format in your discussion (and include the full reference at the bottom).

Be sure to reply to AT LEAST two other students in a respectful and helpful manner, using proper netiquette. Be sure your reply does more than say "good job." Discuss the actual issues and content, or the replies will receive little to no credit.

Feel free to discuss more than the minimum, and check back in the discussion board often to continue the discussion.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M93132692
  • Price:- $15

Priced at Now at $15, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Compulsory hurdle task skill buildingcreate a title page

Compulsory Hurdle Task: Skill Building Create a title page; begin a table of contents that is a list of headings; identify and list three relevant references in APA6 style. One reference should be a peer reviewed journal ...

Question ethical dilemmas may present themselves in

Question: Ethical dilemmas may present themselves in different ways when working with a forensic population. In this assignment, you will identify a scenario that presents an ethical dilemma and explain how you would res ...

Question though customers look to banks for their financial

Question Though customers look to banks for their financial needs, these institutions are not the only options available. The most attractive institutions to compete with banks are credit unions. They offer the same prod ...

Question topic employee training and development programs

Question: TOPIC: Employee Training and Development Programs in Risk Management Assume that the example risk management program you analyzed in Topic 1 was developed by and is now currently implemented by your health care ...

Describe psychology as the science of mental life and what

Describe psychology as the science of mental life, and what we mean when we describe mental life in terms of cognition, emotion, and motivation.

Assignment - adoption of iso9000 and its relationship with

Assignment - Adoption of ISO9000 and its Relationship with other Factors in China's Service Industry The ISO 9000 series of quality management systems standard has been widely applied all over the world since its introdu ...

Question thinking as a scientistafter considering the

Question: Thinking as a Scientist After considering the scientific method explained in the textbook, write an essay about how it compares to the way nonscientists approach problems. Identify some problems that are solvab ...

Question in attempt to alleviate debt crisis and negotiate

Question: In attempt to alleviate debt crisis and negotiate with the World Bank or IMF, what are some of the stabilization policies developing countries must face? The response must be typed, single spaced, must be in ti ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Assessment task legal case study addressing a public health

Assessment Task: Legal case study addressing a public health issue Background For this assessment task you will write a case study, in a report format, addressing the legislative and regulatory requirements of a contempo ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As