Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Question: Consider the population in which the solution is intended, the staff that will participate, and the key contributors that must provide approval and/or support for your project to be implemented. These stakeholders are considered your audience.

Develop an implementation plan (1,500-2,000 words) using the "Topic 3: Checklist" resource. The elements that should be included in your plan are listed below:

1. Method of obtaining necessary approval(s) and securing support from your organization's leadership and fellow staff.

2. Description of current problem, issue, or deficit requiring a change. Hint: If you are proposing a change in current policy, process, or procedure(s) when delivering patient care, describe first the current policy, process, or procedure as a baseline for comparison.

3. Detailed explanation of proposed solution (new policy, process, procedure, or education to address the problem/deficit).

4. Rationale for selecting proposed solution.

5 .Evidence from your Review of Literature in Topic 2 to support your proposed solution and reason for change.

6. Description of implementation logistics (When and how will the change be integrated into the current organizational structure, culture, and workflow? Who will be responsible for initiating the change, educating staff, and overseeing the implementation process?)

7. Resources required for implementation: staff; educational materials (pamphlets, handouts, posters, and PowerPoint presentations); assessment tools (questionnaires, surveys, pre- and post-tests to assess knowledge of participants at baseline and after intervention); technology (technology or software needs); funds (cost of educating staff, printing or producing educational materials, gathering and analyzing data before, during, and following implementation), and staff to initiate, oversee, and evaluate change.

Prepare this assignment according to the guidelines found in the APA Style Guide, located in the Student Success Center. An abstract is not required.

You are required to submit this assignment to Turnitin. Please refer to the directions in the Student Success Center.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92349192
  • Price:- $30

Priced at Now at $30, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question please answer all questions with a minimum of 100

Question: Please answer all questions with a minimum of 100 words. 1. How are introverts and extroverts formed? Does personality explain this? 2. What did you find most interesting in Chapter 9 (P.O.W.E.R Learning: Diver ...

Watch one full episode of one of the following family based

Watch one full episode of one of the following family based television programs and then write an essay about the parenting skills  demonstrated. The television show I picked is Here Comes Honey Boo Boo. The essay must b ...

Incorporate and edit digital video assignment -assessment

Incorporate and edit digital video Assignment - Assessment Overview - These Assessments will assess your skills and knowledge required to required to incorporate, and edit, digital video into interactive media presentati ...

Question read the case titled prioritizing projects at d d

Question: Read the case titled: "Prioritizing Projects at D. D. Williamson" found in Chapter 2. Write a six to eight (6-8) page paper in which you: 1. Analyze the prioritizing process at D. D. Williamson. 2. Suggest two ...

Question provide examples of experimental and

Question: Provide examples of experimental and nonexperimental research design. Contrast the levels of control applied to each. The response must be typed, single spaced, must be in times new roman font (size 12) and mus ...

Assignment gender identity we are socialized at every

Assignment : Gender Identity We are socialized at every stage in life to conform to our gender identity. Societal reinforcement of tendencies of gender identity is relentless. For example, in hospitals, little girls are ...

Backgroundhepatitis a virus hav can cause liver

Background Hepatitis A virus (HAV) can cause liver inflammation. HAV is highly contagious. The most common method of transmission of this virus is from the infected persons through the fecal-oral route. When infected per ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question 1 what policies programs and procedures does your

Question: 1. What policies, programs, and procedures does your present or former organization have in place to encourage cultural diversity among its employees within your work environment? Research your organization's p ...

Read the article titled police foil 420 million keylogger

Read the article titled: "Police Foil $420 Million Keylogger Scam" found on the eWeek Website. Write a 3-4 page paper in which you: Give an example of the measures, you believe, the government or society can implement to ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As