Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Question: APA style with citation, needs 3 credible sources reference not later than 2013.

Discussion: Patients with endocrine and musculoskeletal disorders often require long-term treatment and care resulting in the need for extensive patient education. By appropriately educating patients, advanced practice nurses can assist patients with the management of their disorders. In clinical settings, patients with endocrine and musculoskeletal disorders typically seek treatment for symptoms that pose problems to their everyday lives as ordinary tasks may become difficult to complete. For instance, patients might have difficulty walking short distances, preparing meals, or even running errands. To reduce these symptoms and additional health risks, it is essential to develop drug therapy plans with individual patient factors in mind.

To prepare:

• Select one of the following endocrine or musculoskeletal disorders: thyroid disease, osteoarthritis, rheumatic arthritis, gout, multiple sclerosis, or fibromyalgia. Consider the types of drugs that would be prescribed to patients to treat symptoms associated with this disorder.

• Select one of the following factors: genetics, gender, ethnicity, age, or behavior. Reflect on how this factor might impact the effects of prescribed drugs, as well as any measures you might take to help reduce negative side effects.
With these thoughts in mind:

Post a description of the endocrine or musculoskeletal disorder you selected including types of drugs that would be prescribed to patients to treat associated symptoms. Then, explain how the factor you selected might impact the effects of prescribed drugs, as well as any measures you might take to help reduce negative side effects.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92872299
  • Price:- $15

Priced at Now at $15, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question provide examples of experimental and

Question: Provide examples of experimental and nonexperimental research design. Contrast the levels of control applied to each. The response must be typed, single spaced, must be in times new roman font (size 12) and mus ...

Case study jacob is a 30-year-old male who came to your

Case Study: Jacob is a 30-year-old male who came to your agency for an addiction assessment. At his first session, he was diagnosed as addicted to cocaine, his drug of choice. Jacob's HMO insurance coverage is limited to ...

Question as you begin your studies at walden you have

Question: As you begin your studies at Walden, you have probably thought about what you hope to gain from the program of study you will complete. What are your hopes and aspirations as an emerging professional beginning ...

Similar to adult deviance juvenile delinquency can be

Similar to adult deviance, juvenile delinquency can be defined and measured in a variety of ways. The one unique characteristic with juvenile delinquency is that the legal definition will vary from one state to another. ...

Question suppose we want to use 2010 as the base year

Question: Suppose we want to use 2010 as the base year instead of 2009. Using 2010 as a base, how much is real GDP in 2005 (use two decimals)? What formula allows me to go back in years? To go forward it's Base year*(1+% ...

Question 1 evaluate the approaches by company executives to

Question: 1. Evaluate the approaches by company executives to align an organization for future growth and success. Give your opinion on the credibility of each approach. 2. Discuss additional approaches not mentioned in ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question discuss why ebp is an essential component of the

Question: Discuss why EBP is an essential component of the practice of a BSN-prepared RN. Identify two ways in which you will continue to integrate evidence into your practice and encourage it within your work environmen ...

Question in this 2-3 page written assignment you will be

Question: In this 2-3 page written assignment, you will be exploring the legal and ethical parameters of the case manager and caring for clients with chronic illness or require transitional and/or end of life care. In th ...

Prompt read report to the attorney general on delays in

Prompt: Read Report to the Attorney General on Delays in Forensic DNA Analysis. Then write a journal assignment in which you answer the following questions: Should DNA testing be mandatory in all cases where DNA is colle ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As