Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Question: Advances in genetics and epigenetics have changed the traditional understanding of mood disorders, resulting in new evidence-based practices. In your role as a psychiatric mental health nurse practitioner, it is essential for you to continually educate yourself on new findings and best practices in the field. For this Assignment, you consider best practices for assessing and treating adult and geriatric clients presenting with mood disorders.

Learning Objectives

Students will:

• Assess client factors and history to develop personalized plans of antidepressant therapy for adult and geriatric clients

• Analyze factors that influence pharmacokinetic and pharmacodynamic processes in adult and geriatric clients requiring antidepressant therapy

• Evaluate efficacy of treatment plans

• Analyze ethical and legal implications related to prescribing antidepressant therapy to adult and geriatric clients

Examine Case Study: An Elderly Hispanic Man With Major Depressive Disorder. You will be asked to make three decisions concerning the medication to prescribe to this client. Be sure to consider factors that might impact the client's pharmacokinetic and pharmacodynamic processes.

1. At each decision point stop to complete the following:

i. Decision #1

• Which decision did you select?

• Why did you select this decision? Support your response with evidence and references to the Learning Resources.

• What were you hoping to achieve by making this decision? Support your response with evidence and references to the Learning Resources.

• Explain any difference between what you expected to achieve with Decision #1 and the results of the decision. Why were they different?

ii. Decision #2

• Why did you select this decision? Support your response with evidence and references to the Learning Resources.

• What were you hoping to achieve by making this decision? Support your response with evidence and references to the Learning Resources.

• Explain any difference between what you expected to achieve with Decision #2 and the results of the decision. Why were they different?

iii. Decision #3

• Why did you select this decision? Support your response with evidence and references to the Learning Resources.

• What were you hoping to achieve by making this decision? Support your response with evidence and references to the Learning Resources.

• Explain any difference between what you expected to achieve with Decision #3 and the results of the decision. Why were they different?

2. Also include how ethical considerations might impact your treatment plan and communication with clients.

Note: Support your rationale with a minimum of three academic resources. While you may use the course text to support your rationale, it will not count toward the resource requirement.

Review the following medications:

• amitriptyline

• bupropion

• citalopram

• clomipramine

• desipramine

• desvenlafaxine

• doxepin

• duloxetine

• escitalopram

• fluoxetine

• fluvoxamine

• imipramine

• ketamine

• mirtazapine

• nortriptyline

• paroxetine

• selegiline

• sertraline

• trazodone

• venlafaxine

• vilazodone

• vortioxetine

Information related to above question is enclosed below:

Attachment:- Data.rar

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92884341
  • Price:- $60

Priced at Now at $60, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Background amp readingthe blackface minstrel show is one of

Background & Reading The blackface minstrel show is one of the most controversial types of early American music. Regardless, it has had a tremendous impact on American society (both good and bad). This was America's firs ...

What are some of supers concepts of career maturity and

What are some of Super's concepts of Career maturity and what are some views of its importance to adolescent clients. (Adolescent Career Development)

Question increased demand for health care services leads to

Question: Increased demand for health care services leads to an increasing need for health care organizations to be cost efficient. What are the factors that impact an organization's financial viability? The response mus ...

Question create a 1200-1500-word safety plan for a client

Question: Create a 1,200-1,500-word safety plan for a client similar to Ted, who had been diagnosed with schizophrenia that addresses potential depression and suicidality. Include the following in your safety plan: 1. Wh ...

Prepare start by reviewing general education curriculum

Prepare: Start by reviewing General Education Curriculum found in General Academic Information and Policies in the Ashford University Catalog, which addresses the core competencies that the general education courses must ...

The story of this paper is a veteran police officer smith

The story of this paper is a veteran police officer Smith received an anonymous call on his cell phone from person selling drugs the office came on into the scene and bump into the suspect and search the citizen and foun ...

Go to the following website criminal findlaw and read the

Go to the following website: "criminal findlaw" and read the information related to probable cause. Next, in your own words, discuss the possible changes you see coming in this area as it relates to the Bill of Rights. P ...

Question choose a debatable issue about which you have some

Question: Choose a debatable issue about which you have some knowledge--either through personal experience, televised newscasts, the Internet, or reading. In a multi-paragraph essay, take a stand on the issue by making a ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Consider the following two scenariosscenario 1employees

Consider the following two scenarios: Scenario 1 Employees work in an atmosphere of distrust and fear. Leaders make decisions behind closed doors. Changes to processes and staffing often occur unexpectedly without warnin ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As