Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Question 1:

1) From the following list, select 2 pairs of comparisons. You will be selecting a total of 4 items.  For each pair, compare the significance, ritual use, or cultural function or purpose. Always include an example of art work for each item, either from the book or internet with a link.  Look for interesting similarities and important differences between the items you have selected.

1) ijele

2) iwan

3) nkisi (pl. minkisi)

4) nkondi (pl. minkondi)

5) muqarnas

6) nowo

7) chattri 

8) dao

9) bodhisattva

10) devaraja 

11) garbhagriha

12) haboku 

13) haniwa

14) jia

15) koan

16) kondo

17) pagoda

18) raigo

19) shikhara

20) stupa

21) tanka 

22) taotie

23) yakshi

24) Zen

25) duk duk

26) kachina

27) kiva

28) potlatch

29) tubuan

30) tumbaga

Question 2

2) In Islamic culture, there are certain religious restrictions on use of imagery and representation of human or animal forms is forbidden in many art forms. As a result, Islamic art has developed highly sophisticated abstract, geometric, and linear decorative elements. Compare and contrast this aspect of Islamic art with art of another culture we have studied (your choice) that is centrally concerned with pictorial representations of iconic figures or realistic depictions of historical events or realistic situations. In your discussion, consider the various elements of art and design principles covered in Unit I of this course. As always, use specific examples of art.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91373192
  • Price:- $20

Guranteed 24 Hours Delivery, In Price:- $20

Have any Question?


Related Questions in Homework Help/Study Tips

Using the feedback on your problem statement draft a

Using the feedback on your problem statement, draft a CaRS-style introduction, following Swales and Feak ch. 8 (esp. p. 331). Your introduction may still have some holes in it, especially around Move 3. But you should be ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question research three venture capitalist firms or banks

Question: Research three venture capitalist firms or banks they are listed down below U.S. Venture Partners, Intel Capital, and Google Ventures. Evaluate the pros and cons of completing a competitive analysis (using a co ...

Quesiton social workers must be refined observers when

Quesiton: Social Workers must be refined observers when interaction with clients. It is a skill that we must develop. This assignment requires each student to conduct an observation of the child (Infant to 11 year old). ...

Question write your response on the given paragraphmarsha

Question: Write your response on the given paragraph: Marsha, we are about to turn a corner. As we analyze our organizations we must look at what makes them tick, and where they are postured to move forward in the future ...

Project task assignmentdesign project ideasbackgroundthis

Project Task assignment Design Project Ideas Background This is the time to create project ideas. The project is a design problem that includes at least one distinct component for each member of the group. The components ...

Overviewthis course has three written assignments that

Overview This course has three written assignments that build upon one another and are designed to take you step-by-step through a process of writing a paper that identifies an ethical question, examines the context, iss ...

Question 1explain the purpose of the blood-brain barrier

Question: 1. Explain the purpose of the blood-brain barrier and how it functions. Include discussion of the types of substances that can pass through and effect the brain. Your response should be at least 500 words in le ...

In todays fast-paced world do you think writers are less

In today's fast-paced world, do you think writers are less careful when sending electronic messages? If so, why? What should a careful writer do?

As the newly appointed assistant to the in-service

As the newly appointed assistant to the In-service Coordinator, your responsibilities include ensuring all newly hired nurses and physicians are familiar with the legal and ethical guidelines of the facility. Discuss the ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As