Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Question 1. How much energy does 10 grams of carbohydrates provide?
20 calories
60 calories
80 calories
40 calories

Question 2. Which of the following sports is the least likely to place a young girl or woman at risk for the female athlete triad?
Figure skating
Soccer
Diving
Distance running

Question 3. Which of the following BEST describes exercise?
Any movement produced by muscles that increases energy expenditure
Maximal force or tension level that can be produced by a muscle group
Leisure physical activity that is purposeful, planned, and structured
Ability to move a joint fluidly through the complete range of motion

Question 4. Joseph plays basketball for his high school team and he is concerned that he is not consuming enough kilocalories to support his activity. Which of the following would be the best indicator that he is not consuming adequate kilocalories?
His performance has been impaired.
He is losing weight.
His blood glucose levels are low.
His hemoglobin is low.

Question 5. The type of eating disorder characterized by episodes of binging and purging is:
anorexia nervosa.
bulimia nervosa.
compulsive eating disorder.
binge eating disorder.

Question 6. What is meant by the notion that eating behaviors are conditioned?
Eating habits affect our moods.
Previous experiences, such as those that occur during childhood, affect our current responses to food and eating behaviors.
Food consumption only occurs in response to external stimuli.
The intensity and duration of physical activity impacts our response to food and eating habits.

Question 7. Which of the following BEST explains why individuals with anorexia nervosa have an increased risk for developing osteoporosis?
Decreased estrogen production
Frequent electrolyte imbalance
Malabsorption of calcium
Low body weight

Question 8. Which of the following is the most common eating disorder?
Anorexia nervosa
Bulimia nervosa
Binge-eating disorder
Pica

Question 9. Which of the following eating disorders is the most common among men?
Anorexia nervosa
Bulimia nervosa
Binge-eating disorder
Reverse anorexia

Question 10. Which of the following would NOT be an appropriate treatment strategy in treating someone with anorexia nervosa?
Psychotropic medications
Minimum weight gain of five pounds/week
Family therapy
Restoration of healthy eating habits

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91702117
  • Price:- $10

Priced at Now at $10, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question answer the questions to all three examples for

Question: Answer the questions to all three examples for full credit. 100 words maximum. 1. "Airbag" by Radiohead showcases their style of incorporating experimental sonorities within traditional pop music formats. How d ...

Question negotiation is a very tricky subject it requires a

Question: Negotiation is a very tricky subject. It requires a lot of planning and processing. There are several steps involved in proper negotiation. The first step is to analyze the negotiation topic. We need to know ab ...

Quesiton please answer these 2 questions and put in apa

Quesiton: Please answer these 2 questions and put in apa format and any references 1) What are potential problems with having a staffing process in which vacancies are filled (1) on a lottery basis from among job applica ...

What is tension headache what are the symptoms and

What is tension headache? What are the symptoms and treatment of tension headache?

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Blume l b amp zembar m j 2007 middle childhood to middle

Blume, L. B., & Zembar, M. J. (2007). Middle childhood to middle adolescence. Upper Saddle River, NJ: Pearson [Vital Source e-reader]. Chapter 1, "Studying Middle Childhood and Adolescence"y of Development In this week's ...

Consider a 100m2 slab of pavement in toronto latitude 44

Consider a 100m^2 slab of pavement in Toronto (latitude 44 degree N) at noon on the winter solstice. The pavement has an albedo of 0.1. What is the flux of incoming energy in Watts per m^2? (Hint: you will need the solar ...

Criminal profilingdiscussion questionsexplain the

Criminal Profiling Discussion Questions Explain the difference between signature behavior and offender signature. Explain the difference between active signature behaviors and passive signature behaviors. Provide one exa ...

Compulsory hurdle task skill buildingthis exercise is

Compulsory Hurdle Task: Skill Building This exercise is intended to give students an opportunity for orientation to academic writing, with feedback prior to graded assessments. Preliminary work for Assessment Task 1 will ...

Question please watch the videoshelping the faceblind see -

Question: Please watch the videos: Helping the Faceblind See - Prosopagnosia (also known as face blindness) is a condition that refers to the inability to recognize a face that you've seen before and should be able to re ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As