Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Question - According to Yosso (2006), "Critical race counterstorytelling is a method of recounting the experiences and perspectives of racially and marginalized people. Counterstories reflect on the lived experiences of People of Color to raise critical consciousness about social and racial injustice. Indeed, Communities of Color cultivate rich and continuing traditions of storytelling. Recognizing these stories and knowledges as valid and valuable data, counterstorytellers challenge majoritarian stories that omit and distort the histories and realities of oppressed communities...counterstories bring attention to those who courageously resist racism and struggle toward a more socially and racially just society" (p. 10).

How is Queen Latifah's SNL clip an example of a counterstory? What microaggression examples does she discuss? Why are they microaggressions?

What is your critical [insert category here] counterstory? Although you may have several, select one counterstory to share with the class. Make sure to discuss the transformative, or positive element, that came out of the experience.

Address the instructor-initiated questions listed below in a minimum 250 word post. You ALSO need to select ONE student reading presentation (NOT a student responding to me) and respond to the DB questions embedded in their presentation to receive full credit. EACH response should be at least 250 words (for a total of a minimum of 500 words). Please make sure to integrate your references within your response (and not after).

Attachment:- Assignment Files.rar

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92727558

Have any Question?


Related Questions in Homework Help/Study Tips

Question scenario you are a junior analyst at a 500-bed

Question: Scenario: You are a junior analyst at a 500-bed nonprofit hospital in a competitive metropolitan market. You have been asked by the CFO to work on the financial operating plan for the upcoming fiscal year. The ...

Satre argues that we make ourselves through our

Satre argues that we make ourselves through our choices. Describe his argument for his point of view. Is Satre correct about free will being the main factor that determines who you are-or do such things as genetics and s ...

Question national security responsibilities fall across

Question : National security responsibilities fall across many entities in the federal government. Which department, agency or bureau has the most influence and why? Include a recent news article from the last eight week ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Assignment 1 internet of things devicesbullconsider the

Assignment 1: Internet of Things Devices • Consider the various types of mobile and Internet of Things (IoT) devices. What are the common risks associated with them? • Based on what you have learned this week, would you ...

Question please read the case hubspot available in the

Question: Please read the case Hubspot (available in the readings packet you purchased from Harvard) and answer the following questions. These are open ended questions. Think through before answering. The answers are due ...

Question 1 what is the difference between research- and

Question: 1. What is the difference between research- and evidence-based practice projects? Provide an example of each one and the reason for the difference. Why should nurses be interested in learning about EBP? And how ...

In 500-750 words design a brochure for general education

In 500-750 words, design a brochure for general education teachers detailing the following about Child Study Teams: Identify why a Child Study Team would be assembled and who would be a part of the team. Explain each tea ...

Question evaluate the presence and effects of alteration in

Question: Evaluate the presence and effects of alteration in the homeostatic state secondary to gender, genetic, ethnic and temporal variables Select one of the case studies below, and include in your discussion an evalu ...

Question pick a topic relevant to the information we have

Question: Pick a topic relevant to the information we have covered to date, including this week. It can cover information in Chapters 1,2,3, and 9, or any of the articles presented in the readings area. The format of you ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As