Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Project

Overview

The final project for this course is the creation of a concept map and paper.

Sociology is the scientific study of human behavior. Professionals in the field apply a sociological lens to examine various influences on society in order to better understand current and historical behaviors. This perspective assists professionals in examining various social structures and institutions, which are systems in society that influence human behavior, to inform their understanding of groups as well as daily interactions with diverse viewpoints.

For this project, you will examine a contemporary social issue using your sociological lens. You will create a concept map, breaking the social issue that you have chosen into smaller pieces related to certain sociological concepts, describe the relationship of the concepts and smaller pieces to the social issue, and explain how the sociological concepts help you better understand the social issue.

The project is divided into three milestones, which will be submitted at various points throughout the course to scaffold learning and ensure quality final submissions. These milestones will be submitted in Modules Two, Four, and Five. The final concept map and paper will be submitted in Module Seven.

In this assignment you will demonstrate your mastery of the following course outcomes:

  • Explain cultural beliefs and biases utilizing a sociological lens
  • Explain the influences that shape the creation of roles within society utilizing real-world examples
  • Draw basic connections between social inequalities and human behavior
  • Identify the relationship between social change and contemporary social problems through the application of basic sociological concepts

Prompt

You will begin by selecting your own contemporary social issue to use as the base of your project. You may use an issue from the list provided below or choose an issue of interest to you that you find in the news or media, or perhaps one you encounter in your daily life.

  • Bullying
  • Crime and violence
  • Drug and alcohol abuse
  • Income inequality and wealth distribution

You will then create a concept map to break down your selected issue into supporting sociological concepts. These sociological concepts will include:

  • Cultural beliefs and biases
  • Social roles
  • Social inequalities
  • Existing social conditions

You will also explain the relationship between the sociological concepts and the social issue, describing how the concept is present in the social issue. In paper format, you will explain how the connections you made in the map between the sociological concepts and the social issue helped you better understand the social issue. This is where you will demonstrate the importance of using a sociological view when examining social issues.

Specifically the following critical elements must be addressed:

I. Topic Selection: To begin this project, you will identify and summarize the contemporary social issue you selected, citing resources to strengthen your summary. Explain what is happening in the issue, and provide a brief history of how the issue began.

II. Mapping the Issue: Now that you have selected your social issue, you will break the issue into smaller pieces. You will break the issue down into the following sociological concepts: cultural beliefs and biases, social roles, social inequalities, and the existing social conditions. These concepts will serve as categories through which you examine the issue, as you will identify how each is present in the issue. To represent this process, you will create a concept map connecting the sociological concepts and their smaller pieces to the social issue.

A. Identify in the map the cultural beliefs and biases present in the social issue. For example, there may be prejudice or discrimination at play.

B. Identify in the map the social roles played by the main individuals or groups in the social issue. For example, an individual may be a mother and/or teacher.

C. Identify in the map the social inequalities present in this social issue. For example, there may be racism or sexism at play.

D. Identify in the map the existing state or conditions that the social issue is challenging. For example, if your issue is that recycling is bad, the existing condition may be that recycling is good.

III. Creating Connections: Now that you have broken the social issue down into smaller pieces in the concept map, you will explain the connections you made and how these connections will help you better understand the issue, using your knowledge from the course. You will describe the connections between the sociological concepts and the social issue and demonstrate the value of using a sociological view when examining social issues.

A. Cultural

1. Describe the relationship between the cultural beliefs and biases identified in the map and the social issue, and provide specific examples to support your description. For example, you might describe how the relationship is positive, negative, or strained.

2. Explain how the cultural beliefs and biases identified in the map help you better understand the social issue.

B. Social Roles

1. Describe the relationship between the social roles identified in the map and the social issue, and provide specific examples to support your description. For example, you might describe how the relationship is positive, negative, or strained. In your response, you might consider what expectations are in place because of the social roles.

2. Explain how the social roles identified in the map help you better understand the social issue.

C. Social Inequalities

1. Describe the relationship between the social inequalities identified in the map and the social issue. How are the social inequalities present in the issue?

2. Explain how the social inequalities identified in the map help you better understand the social issue.

D. Impact of Social Change

1. Describe how the social issue is challenging the existing state or conditions, providing specific examples.

2. How might the social issue facilitate change for the existing state or conditions? Provide specific examples.

Attachment:- Assignment File.rar

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92284817
  • Price:- $40

Priced at Now at $40, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Please identify and fix passive voicewuthering heights is a

Please identify and fix passive voice? Wuthering Heights is a classic work of literature that matches with various elements of Victorian literature particularly through the theme of love. Romantic love takes several form ...

Question sexuality and social controlrespond to one of the

Question: Sexuality and social control Respond to one of the following questions: 1. How do you define romantic love? How is romantic love portrayed in the media? In your explanation, include specific examples and addres ...

Assignment 1 internet of things devicesbullconsider the

Assignment 1: Internet of Things Devices • Consider the various types of mobile and Internet of Things (IoT) devices. What are the common risks associated with them? • Based on what you have learned this week, would you ...

Question instructions imagine that you are the human

Question: Instructions: Imagine that you are the human resources (HR) manager at a company. The company you work for is trying to determine whether it would be better for its employees to be compensated using a merit-bas ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question media strategyarticle research assignmentthe

Question: Media Strategy Article Research Assignment: The purpose of this assignment is to acquaint you with the sources for advertising media news and to demonstrate the breadth of the advertising media field. Find and ...

Question describe a public space that you had visited i

Question: Describe a public space that you had visited ( i would prefer you write about Starbucks or Walgreen and walmart etc..) describe that space, and explain why you think the designers included the particular design ...

Question review the case study turnaround and

Question: Review the case study, "Turnaround and Transformation at Duke University Children's Hospital," found on pages 25-26 of the course textbook (ATTACHED).. Write an APA-formatted essay with a minimum of 900 words t ...

Assignment - community practice portfoliothis assessment

Assignment - Community Practice Portfolio This assessment has four parts: 1. Introduce your Professional Practice setting and describe the health services this practice setting provides (200 words). Include artefacts (i. ...

Boot campsthe use of boot camps shock incarceration is more

Boot Camps The use of boot camps (shock incarceration) is more frequently administered as a court sanction for adults. However, a few states allow 15 and 16 year olds to be sentenced to a juvenile boot camp. View the bel ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As