Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Program Evaluation: The Accountability Bridge Model for Counselors

Astramovich, Randall LAuthor InformationView Profile; J Kelly CokerAuthor InformationView Profile. Journal of Counseling and Development : JCD; Alexandria85.2 (Spring 2007): 162-172.

This activity is aligned with CACREP standards SC.A, A.1, C.2, I.1, K.1, K.3, O.3, and P.1.

Throughout the term you have learned how to evaluate a comprehensive school counseling program using the Accountability Bridge Model.

In this assignment you will apply that model to the school counseling program in your hypothetical school. Keep in mind the needs assessments and the interventions you developed in previous assignments.

Using the Accountability Bridge Model, describe a step-by-step process for evaluating your comprehensive school counseling program. Describe how your program evaluation can be used to design future enhancements to your school counseling program.

Be sure to evaluate each identified program, for academic, career, and personal or social needs. Explain how your counseling program can meet the needs of all students and populations.

Be sure to review the Program Evaluation Scoring Guide to ensure that you meet all of the evaluation criteria for this assignment.

Submission Requirements

You are required to submit your final version of this paper to Turnitin to generate a final report prior to submitting the assignment for grading. From the Turnitin tool, use the Final report option for the assignment.

When your paper is downloaded and viewable in Turnitin, save the originality report. Refer to the Turnitin.com Tutorial: Viewing Originality Reports (linked in the assignment Resources) for guidance.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92331126
  • Price:- $40

Priced at Now at $40, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question please read directions fieldwork essaykinesics the

Question: Please read directions: FIELDWORK ESSAY KINESICS: the study of body motion or body behavior. • Emblems: gestures that have a direct verbal translation and can stand alone such as the "ok" sign. • Illustrators: ...

Social stress and healthlearning outcomesafter reading this

Social Stress and Health Learning Outcomes After reading this article from the book Worried Sick, listening to the podcast linked below, and completing this reading guide, you will be able to (1) Describe common ways tha ...

Question effects of illness on womens relationshipsin

Question: Effects of Illness on Women's Relationships In addition to affecting the lives of those who are ill, illnesses may also profoundly affect the spouses or partners who care for those who are ill. Anxiety and depr ...

What is the difference between cattels surface traits and

What is the difference between Cattel's surface traits and source traits? What are some examples?

Assignment 3 essay anxiety and attentionpart i compare and

Assignment 3: Essay: Anxiety and Attention Part I: Compare and contrast how the anxiety-performance relationship is explained by the individual zones of optimal functioning model, multidimensional anxiety theory, and cus ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

1 how are basics of defense and the levels of security

1. How are basics of defense and the levels of security related? 2. What perimeter and building controls (interior and exterior) are usually implemented? 3. How are human protection systems, alarm systems, and fire prote ...

Question traditional experimental research dictates that

Question: Traditional experimental research dictates that there must be one or more experimental groups (groups receiving a treatment or intervention) and a control group (which does not receive the intervention). Partic ...

Question as we have discussed previously the us healthcare

Question: As we have discussed previously, the U.S. healthcare system is very complex and dynamic. As such, there are always changes taking place and challenges to be addressed by healthcare organizations and their leade ...

Question write your response on the given paragraphmarsha

Question: Write your response on the given paragraph: Marsha, we are about to turn a corner. As we analyze our organizations we must look at what makes them tick, and where they are postured to move forward in the future ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As