(Answered) Problemcomputer-based technologies such as gis data mining

Others

Problem

Computer-based technologies, such as GIS, data mining, and Web-based applications, offer new possibilities for the study of epidemiology and the control of pandemics.

Based on your research of module readings, Argosy University online library resources, and the Internet, respond to the following:

• What is a GIS?

o How is GIS currently used to improve the practice of epidemiology?

• What is data mining?

o How is data mining currently used in epidemiology practice and research?

• How might developing Internet and Web technologies impact the use of GIS and data mining in public health in innovative ways?

Write your response in a minimum of 300-400 words, providing relevant references. Apply APA standards to citation of sources. Use recent, scholarly references.

View complete question

Homework Help/Study Tips, Others

Category:- Homework Help/Study Tips
Reference No.:- M92719148
Price:- $20

Verified Expert

Priced at $40 Now at $20, Verified Solution

Have any Question?Write your Review or question?

Related Questions in Homework Help/Study Tips

Topic scenario analysis assignmentdirectionsread the four

Topic : Scenario Analysis Assignment Directions:Read the four scenarios below. Provide a 75-150-word response to each questionin all four of the scenarios presented below. Use the ACA and NAADAC Codes of Ethics and other ...

Question write a 1050- to 1400-word paper in which you

Question: Write a 1,050- to 1,400-word paper in which you examine clinical psychology. Address the following items: • Discuss the history and evolving nature of clinical psychology. • Explain the role of research and sta ...

Question in this assignment you will have the opportunity

Question: In this assignment, you will have the opportunity to select two Spanish-speaking countries of your choice, each one from a different continent. You will continue with these countries for your individual assignm ...

Question select one issue from the transitional care

Question: Select one issue from the Transitional Care scenario in the Allied Health Community and write a new policy and procedure related to the issue. Write a 500-word memo to your supervisor that describes this issue ...

After reviewing your report on the katrina debacle the city

After reviewing your report on the Katrina debacle, The City of Palms asked you to continue your role as an emergency management consultant. The city sees a need to train personnel on identifying hazards. Create a media- ...

Question no more than 2 pages apa format and 3 scholarly

Question: No more than 2 pages!! APA format and 3 scholarly articles (NO OLDER THAN 5 YEARS). Choose one communicable disease from the following list: • Chickenpox • Tuberculosis • Influenza • Mononucleosis • Hepatitis B ...

Quesiton you have been called in to consult on cases that

Quesiton: You have been called in to consult on cases that may require mandated treatment. After reviewing the PSY699 The ethics of mandated treatment scenarios, choose two to discuss in your initial post. Begin your res ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Instructions very often the same product is marketed to men

Instructions: Very often the same product is marketed to men and to women in very different ways, products that by definition aren't necessarily "gendered." For this essay, find two magazine ads for three different types ...

Question in order to evaluate an evidence-based practice

Question: In order to evaluate an evidence-based practice project, it is important to be able to determine the effectiveness of your change. Discuss one way you will be able to evaluate whether your project made a differ ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Homework Help/Study Tips Expert