Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Positive Psychology and Spirituality

Substance abuse counseling lends itself nicely to the integration of positive psychology and spirituality. While both of these therapy approaches have been explored for many years, the integration into substance abuse counseling is a relatively new development. As such, many clients may not be aware of the techniques in positive psychology and spirituality that can be of use in their recovery.

Juanita has been seeking treatment for her marijuana use from you for a month now. While she has significantly cut back on her substance use, she is having difficulty quitting and remaining abstinent for periods that last longer than a few days. In your counseling sessions, Juanita has mentioned that she feels very badly about herself-she feels guilty about being unable to quit and explains that she doesn't think she is strong enough to quit altogether. She has also expressed nervousness that her boyfriend would no longer like her if she quit smoking, and she has expressed concern that if he leaves her, she wouldn't be able to find a new boyfriend because she doesn't believe she is pretty enough. Juanita is also unsatisfied with her job as a cashier at the local grocery store, but has expressed her opinion that she doesn't think she is smart enough to get a better job. You know from Juanita's history, that her mother was very critical of Juanita when she was a child and that her father was absent for most of her childhood. In high school, Juanita excelled at classes in biology and math, but she never attended college.

To help Juanita overcome her barriers to marijuana abstinence, write a summary of what the counselor should cover in the next meeting with Juanita. Ensure that you cover the following points:

Explain the concepts of positive psychology to Juanita.

Examine the goals of positive psychology and explain how this approach will help Juanita obtain sobriety, focusing specifically on the concerns and dissatisfactions she has expressed.

Design at least two exercises based on positive psychology for Juanita to work on in between counseling sessions.

Explain spirituality to Juanita, emphasizing the differences between spirituality and religion.

Examine how spirituality and positive psychology can work together to help Juanita achieve her goals.

NO Abbreviations

Write a 4-5-page paper in Word format. Use scholarly resources, including the textbook to support your ideas. Apply APA standards to citation of sources

Miller, Geri. (09/2014). Learning the Language of Addiction Counseling, 4th Edition: must be used as a reference

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91915710
  • Price:- $35

Priced at Now at $35, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Assignment after reading the material for the module

Assignment After reading the material for the module, conduct a search .Find information on the pros and cons of debt financing. Address the following questions : • Is debt necessary? • Is short term debt better or worse ...

Question values culture and underlying beliefs of human

Question: Values, culture, and underlying beliefs of human services providers may raise dilemmas when handling cases involving issues such as infidelity, domestic violence, and parenting matters. In this week's media pro ...

Consider the following two scenariosscenario 1employees

Consider the following two scenarios: Scenario 1 Employees work in an atmosphere of distrust and fear. Leaders make decisions behind closed doors. Changes to processes and staffing often occur unexpectedly without warnin ...

Question when we consider the word love as a verb instead

Question: When we consider the word love as a verb instead of a feeling, the biblical worldview would state that this loving relationship is related to two principles: honor and protection. Explain how these two principl ...

Project reflective summarywrite a weekly reflective summary

Project: Reflective Summary Write a weekly reflective summary discussing the importance of what you have learned from this week's readings or searches on the Internet. In addition, discuss how this knowledge will be usef ...

Questions -q1 which 1903 case was the most important

Questions - Q1) Which 1903 case was the most important incident to advance the use of fingerprints in the United States? A) Lindberg B) Fauld C) West D) Vucetich Q2) In 1985, research by ______ and his colleagues at Leic ...

Question using the empirical research article that your

Question: Using the empirical research article that your instructor approved in the Week 5 assignment, ask yourself: "Is this a quantitative research article or a qualitative research article?" Remember, in quantitative ...

Question because healthcare is right at the intersection of

Question: Because healthcare is right at the intersection of several rapidly changing industries- medicine, technology, and business- not to mention subject to changes in legislation and regulation, it is one of the most ...

Question - amazon this week held a hardware event that

Question - Amazon this week held a hardware event that loaded with new product announcements. The new Echo speakers, a new Echo Show, a wall clock, and even a microwave (video below). Discuss where are Amazon taking the ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As