Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Please assist me with this question: 1. A patient has the misfortune to have both diabetes insipidus and Addison's disease. How will those conditions affect the patient's ability to regulate blood pressure?

This is what I have so far:

Diabetes insipidus is an abnormality associated with dysfunction of the posterior pituitary. It results because of either defects in antidiuretic hormone (ADH) receptors or an inability to produce ADH. One of the most common symptoms of this disorder is the excretion of large urine volumes, resulting in thirst, dehydration and low blood pressure.

Addison's disease is a disorder caused by the hyposecretion of glucocorticoids and aldosterone. Most of the cases are categorized as autoimmune disorders, where by antibodies result in the destruction of the adrenal cortex or block the binding of ACTH to its receptors. Loss of aldosterone causes elevated potassium, decreased blood sodium, dehydration, decreased cardiac output, arrhythmias, cardiac arrest and low blood pressure.

Both of these disorders result in the hyposecretion of two important hormones that function in increasing blood pressure and maintaining homeostasis.  A patient who has both diseases would suffer from low blood volume, low cardiac output, and extremely low blood pressure. Among other symptoms, they would also suffer from severe dehydration, low electrolytes and the inability to regulate blood pressure.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92694528
  • Price:- $10

Priced at Now at $10, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question details while the implementation plan prepares

Question: Details: While the implementation plan prepares students to apply their research to the problem or issue they have identified for their capstone change proposal project, the literature review enables students t ...

What does it means to synthesize sources in a paper and how

What does it means to synthesize sources in a paper and how is synthesizing different from writing an annotated bibliography?

Question you are leading a new team and want to harness

Question: You are leading a new team and want to harness their creativity. What processes or methods would you use to minimize the threats to creativity and promote innovation among your team members? Directions: Since c ...

Ethical communication for businessessay topic ethical

Ethical Communication for Business Essay Topic: "Ethical Communication is an essential part of business" Discuss this statement using three (3) ethical communication issues as examples. The abstract, essay title, paragra ...

Discuss the followingwhat evidence did you see and hear by

Discuss the following: What evidence did you see and hear by watching Mr. Pronovost Differentiating Instruction Through Interactive Games that supports what has been learned thus far regarding setting & communicating lea ...

Assignment 2 ra diagnostic formulationreview the case given

Assignment 2: RA: Diagnostic Formulation Review the case given below case study (Psychological Evaluation for Jessica E. Smith) for this required assignment (RA). On the basis of the information in the case study, provid ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question this was actually a great topic to discuss about

Question: This was actually a great topic to discuss about because they deal with a form of communication. Its amazing how blackboard and coarse management can handle thousands of kids at once. This most likely increased ...

Software engineering methodologies assignment - formal

Software Engineering Methodologies Assignment - Formal System Specification Overview - The purpose of this assessment is to provide students with the opportunity to apply knowledge and skills developed during the semeste ...

Essay write a 1000 word minimum essay addressing each of

Essay Write a 1000 word minimum essay addressing each of the following points/questions. Be sure to completely answer all the questions. Separate each section in your paper with a clear heading that allows your professor ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As