Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Personal Crimes Analysis

For this assignment, you will create an analysis regarding personal crimes using one of the three assignment options.

Option 1: Personal Crimes Analysis Presentation

Submit your personal crimes analysis using Microsoft® PowerPoint® or another pre-approved presentation tool.

Create a 10- to 15-slide presentation that includes a reference slide with at least four references cited throughout the presentation.

Include the following:

• Differentiate between assault, battery, and mayhem.

• Identify and explain kidnapping and false imprisonment.

• Compare and contrast between rape and statutory rape.

• Choose two states and compare the definitions and punishment for these crimes.

Include appropriate photos, short videos, or headlines, as needed, to represent your analysis.

Format your presentation consistent with APA guidelines.

Option 2: Personal Crimes Analysis Matrix

Create a matrix to complete your personal crimes analysis. Include the following:

• Differentiate between assault, battery, and mayhem.

• Identify and explain kidnapping and false imprisonment.

• Compare and contrast between rape and statutory rape.

• Choose two states and compare the definitions and punishment for these crimes.

Include a reference section with at least four references in the matrix.

Write a 350-word comparative summary following the matrix that includes the required comparisons for each set of crimes.

Format your presentation consistent with APA guidelines.

Attachment:- Creating a Presentation.rar

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92555822

Have any Question?


Related Questions in Homework Help/Study Tips

Accounting concepts and applicationsstudents are required

Accounting Concepts and Applications Students are required to complete the computerised accounting practice set - World of Games - by Pabst and Perrin (2015) on an INDIVIDUAL basis for accounting transactions up to Perio ...

Response and recovery are often matters of life and death

Response and recovery are often matters of life and death. Preplanning is part of response and recovery. Your boss loved the work you did in forum 3. You have just been appointed the new emergency manager for your agency ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Quesiton a group theoretic analysis of 15-puzzlethe

Quesiton: A Group Theoretic Analysis of 15-Puzzle The 15-puzzle, invented by Noyes Palmer Chapman, and popularized by mathematical puzzle-maker Samuel Loyd in late 1980s, is a permutation puzzle best known for the hyster ...

Assignmentfor federal state local and tribal law

Assignment For federal, state, local, and tribal law enforcement officials, striking the delicate balance between homeland security and the civil liberties of Americans is often seen as the most difficult challenge in co ...

Question 1 why should the governments focus should be on

Question: 1. Why should the government's focus should be on productivity not employment? 2. Why is the decentralization of government power good for economy? 3. Estimating unknown model parameters, such as the sensitivit ...

Exercise 1 - develop your own commercialimagine that you

Exercise 1 - Develop Your Own Commercial Imagine that you are your own "product." You have to sell yourself and your potential contributions to a prospective employer, or "buyer." What would you sell? For example, what a ...

Question although many new nationally known programs are

Question: Although many new nationally known programs are available aimed at preventing substance abuse and addictions, many people develop addictions every year. The tendency to develop addiction varies with different a ...

Question based on the article from the weekly required

Question: Based on the article from the weekly required readings entitled, "Workplace communication problems: Inquiries by employees and applicable solutions," with a specific focus on the section Communication Skills Ed ...

Question in a formal paper of 1000-1250 words you will

Question: In a formal paper of 1,000-1,250 words you will discuss the work of the Robert Wood Johnson Foundation Committee Initiative on the Future of Nursing and the Institute of Medicine research that led to the IOM re ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As