Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Part A of the Systems Leadership Project will consist of identifying a quality improvement or evidence-based or knowledge-based issue in an area of nursing practice relevant to your role as a DNP. The area may be in a
Hospital;
Clinic;
public health agency;
non-governmental agency; and
global health, policy arena.

You are to select a problem in an area of interest for you, for example:

addressing hospital throughput issues as a nurse executive
changing the clinic staffing matrix of an interdisciplinary clinic
Lean or Six Sigma improvement strategies
implementing purposeful rounding and bedside reporting based on best practices to improve HCAHPS scores
reorganizing the care delivery model of various nursing units based on evidence from Magnet hospitals
designing and implementing a culture of safety and identifying areas of nursing program growth as an administrative dean of an online nursing program

You must address the following objectives.

Problem identification-quality improvement or evidence-based or knowledge-based issue (1 page)

The problem needs to be current and relevant to the organization or clinic.

The problem needs to include cost, quality, and efficiency aspects.

The problem needs to match the mission or vision statement of the organization and organizational strategic plan for the next 5 years.

Significance of the problem as it relates to healthcare leadership, academics, finance and economics (2 pages)

What leadership elements are crucial to the success of this problem area?

State several significant areas that the problem relates to-leadership and finance, academics, and economics.

Literature review related to what is known about the significance of the problem, what is not known, and how your project plans could potential fill the gap (3 pages)

Your role as a DNP in addressing the problem (2 pages)

What are the key leadership challenges at this time that may enhance acceptance of the project or resistance? How will the organization climate support the change?

What leadership skills are most conducive to create a favorable proposed change process?

Key stakeholders identified and several key measures or indicators of healthcare outcomes that is important to stakeholders and that you will use in addressing the problem area (2 pages)

Identify stakeholders that will support change in the problem area.

Identify stakeholders that will create resistance in change.

Identify stakeholders that will have the greatest influence over positive or negative changes related to the problem area. Identify ways in which to work with all the various groups of stakeholders.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92469778
  • Price:- $10

Priced at Now at $10, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Scenario a a researcher wants to see how people respond to

Scenario A: A researcher wants to see how people respond to three new ad campaign for potato chips. One is funny (A sleeping guy thinks he is eating the best tasting potato chips in the world, though when he wakes up he ...

Should a jury scrupulously follow the law to a conviction

Should a jury scrupulously follow the law to a conviction if it feels is unjust? Or should the jury exercise its secret power to ignore the law and deliver an acquittal, which it believes to be just? Can a person justify ...

What are at least two ethical issues associated with

What are at least two ethical issues associated with clinical psychology? Provide an example of a situation that could be ethical but illegal. Explain your response.

Question read the article cleveland shooting highlights

Question: Read the article Cleveland Shooting Highlight's Facebook's Responsibility in Policing Depraved Videos. Write a four to five (4-5) page paper in which you: 1. Discuss whether or not you believe that Facebook has ...

Quesiton about your signature assignmentsignaturebenchmark

Quesiton: About Your Signature Assignment Signature/Benchmark Assignments are designed to align with specific program student learning outcome(s) in your program. Program Student Learning Outcomes are broad statements th ...

Question professional associations in psychologyfor this

Question: Professional Associations in Psychology For this assignment, you will examine the various associations in psychology as they relate to your interests in psychology. For example, if you are interested in Forensi ...

Course projectlast week you completed the literature review

Course Project Last week, you completed the Literature Review section of your paper. This week, you will complete the Description of the Program section of your paper, and then submit the work that you have completed to ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question note online students please select one of the two

Question: Note: Online students, please select one of the two subjects to discuss. • Select one (1) project from the working or educational environment of your choice and specify the main work process (e.g., suppliers an ...

Leadership requirements paper instructionsfor this

LEADERSHIP REQUIREMENTS PAPER INSTRUCTIONS For this assignment, you will write a two-section paper describing both formal and informal requirements to serve as a leader in an organization. This assignment must be in APA ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As