Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Part 1: Healthy People 2020

Healthy People 2020 is an initiative established by the US Department of Health and Human Services to monitor the progress of the population in reaching national goals and objectives designed for health promotion and prevention. Healthy People 2020 is the product of extensive input from stakeholders. Many of its goals and objectives have been met, but there is still progress to be made.

From the assigned readings this week, review the following Web site:

• U.S. Department of Health and Human Services: Healthy People 2020. (2012).http://www.healthypeople.gov/2020/topicsobjectives2020/default.aspx

Review the listed topics and objectives of Healthy People 2020 and select one that is of interest to you. Then, respond to the following:

• Explain why the objective you chose is of great significance to the population and the health of the communities.

• Describe the federal program established in response to your selected objective.

• Examine the implications of the program in healthcare in terms of morbidity, mortality, policy, and costs.

Support your statements with appropriate examples and scholarly references.

Part 2: The Patient Protection and Affordable Care Act

The Patient Protection and Affordable Care Act (PPACA) of 2010 is a pivotal piece of legislation aimed to improve the current healthcare system in the United States. The legislation intends to ensure that all American citizens have access to good quality and affordable healthcare. One of the main focuses of the act is preventing chronic disease and improving public health.

From the assigned readings this week, review the following Web resource:

• The White House. (n.d.). Health reform in action. Retrieved fromhttp://www.whitehouse.gov/healthreform/healthcare-overview

Considering that the PPACA bill recommends the elimination of copayments (or copays) and deductibles for preventative healthcare for women, respond to the following:

• Provide a brief overview of PPACA.
• What are the implications of the PPACA for public health?
• In your opinion, do you think that the elimination of copays and deductibles will increase the number of women who have annual mammograms? Justify your answer.
• Even if these screening services are available, what would be the barriers to accessing these services?

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91947151
  • Price:- $50

Priced at Now at $50, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question the control process involves three phases that are

Question: The control process involves three phases that are cyclic: establishing standards, measuring performance, and correcting deviations. Examine the manner in which health care leaders progress through each phase o ...

Tools of the tradebriefly describe one of the tools or best

Tools of the Trade Briefly describe one of the tools or best practices of strategic planning or execution (implementation) (SWOT, Service-Value Chain, Appreciative Inquiry, etc.). Provide a URL/web link or reference for ...

Assignmenta with the guidance from the content of slide 6

Assignment (a) With the guidance from the content of slide #6 on reading ; discuss the importance of DM in health care; (b) If decision environments in health care may include certain, risk or uncertain environments. Wha ...

Please start your paper providing the title of the article

Please start your paper providing the title of the article you chose. (1) What is the rhetorical artifact analyzed in the article? In other words, what "thing" did the author analyze in the paper? (2) Can you identify a ...

The weight of the nation part 1 part2 part3 part4 vediosin

The Weight of the Nation( part 1, part2, part3, part4) vedios. In the documentary series, many factors impacting obesity in the US were addressed. What part of the series did you find the most fascinating? In your opinio ...

Question for the unit ii case study you will focus on fires

Question: For the Unit II Case Study, you will focus on fires and fire prevention in your community, specifically structural fires and wildfires. Start by conducting research around your community/location for examples o ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Individuals transitioning from an institutional

Individuals transitioning from an institutional correctional setting to a community correctional setting may have different needs than those individuals entering an institutional setting. In this assignment, you will rev ...

Assignmentcreate a 5 page not including reference page and

Assignment Create a 5 page (not including reference page and title page) photo storybook examining: Early roots of policing, Sir Robert Peel's, during the 1820s, nine principles, and their connection to modern-day polici ...

Assessment - written reportfocus of report analysis of

Assessment - Written Report Focus of report: Analysis of HRM-related issues and their solutions You are required to investigate current HRM-related issues in the workplace. You are to conduct research into a workplace of ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As