Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Overview/Description:

Throughout this course, you were provided case studies that focused on cardiovascular, pulmonary, genitourinary, and musculoskeletal disorders. You will pick one of these cases to analyze and create a comprehensive care plan for acute/chronic care, disease prevention, and health promotion for that patient and disorder. Your care plan should be based on current best practices and supported with citations from current literature, such as systematic reviews, published practice guidelines, standards of care from specialty organizations, and other research based resources. In addition, you will provide a detailed scientific rationale that justifies the inclusion of this evidence in your plan.

Your paper should adhere to APA format for title page, headings, citations, and references. The paper should be no more than 10 pages typed excluding title page and references.

Criteria:

Case Study Evaluation

Analyze the disorder addressing the following elements: pathophysiology, signs/symptoms, progression trajectory, diagnostic testing, and treatment options.

Differentiate the disorder from normal development.

Discuss the physical and psychological demands the disorder places on the patient and family.

Explain the key concepts that must be shared with the patient and family to achieve optimal disorder management and outcomes.

Identify key interdisciplinary team personnel needed and how this team will provide care to achieve optimal disorder management and outcomes.

Interpret facilitators and barriers to optimal disorder management and outcomes.

Describe strategies to overcome the identified barriers.

Care Plan Synthesis

Design a comprehensive and holistic recognition and planning for the disorder.

Address how the patient's socio-cultural background can potentially impact optimal management and outcomes.

Demonstrate an evidence-based approach to address key issues identified in the case study.

Formulate a comprehensive but tailored approach to disorder management.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91978418

Have any Question?


Related Questions in Homework Help/Study Tips

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Assignment - business process redesign reportin this

Assignment - Business Process Redesign Report In this assignment you will analyse, model and design improvement to a business process from a real organisation of your choice.Your submission will take the form of a report ...

Assignment reflective practitioner journal response

Assignment : Reflective Practitioner Journal Response 3-Assessing Oral Language and Vocabulary In this assignment, you will write the third reflective journal response of this course. You will write six such journal resp ...

Question chapter 10 as well as your required resources

Question: Chapter 10, as well as your required resources, address employee attitudes and suggest that an increase in job performance is reliant on job satisfaction. The authors of our text suggest that highly satisfying ...

Question your assignment is to apply the principles and

Question: Your assignment is to apply the principles and concepts of Dr. Blevens' lecture on secrecy in an analysis of The Insider. 1. The mainstream media often face enormous challenges in trying to give audiences an ac ...

Assignment nonverbal communicationimagine that you are

Assignment : Nonverbal Communication Imagine that you are forming a small professional group to discuss how the statistics and research of a human services organization can be improved. You would also need to present the ...

Question how were civil rights of all americans initially

Question: How were civil rights of all Americans initially impacted by the implementation of the 13th, 14th, and 15th Amendments? How were they circumvented and by whom? Finally, how did the civil rights guaranteed by th ...

Discuss how racialethnic ambiguity the multi- versus

Discuss how racial/ethnic ambiguity, the multi- versus monoracial debate, the marginal syndrome, stereotypes/myths about interracial couples and bi/multiracial people impact society at large.

It risk management assignment -risk assessment report -

IT RISK MANAGEMENT ASSIGNMENT - Risk Assessment Report - Your deliverable for this IT Risk Assessment report, written for the intended audience of management providing a risk assessment of a project. The project can be i ...

How should we draw the line between normality and

How should we draw the line between normality and disorder? How are Psychological Disorders Diagnosed? Discuss the axes of the DSM V. How does biological, psychological, and social-cultural factors interact to produce sp ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As