Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Often when providing services, basic intake information is required.  The researcher could, at the end of a given time period, examine these intake papers and, based on some need, compute descriptive statistics using information provided by the clients / participants.  Information such as income, family make up, and education levels could be used to compute mean values.  However, you may be asked to configure a study that can be called experimental.  In this discussion forum you are asked to compare these two formats and identify in what ways they differ.  In order to determine definitions of descriptive research, you will need to access the MREL Appendix A.  Your post should focus on differentiating these two research types and then discuss their potential contribution to research in health and human services.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91370312
  • Price:- $15

Guranteed 24 Hours Delivery, In Price:- $15

Have any Question?


Related Questions in Homework Help/Study Tips

Question a minimum of 150 words each question and

Question: A minimum of 150 words each question and References (questions #1-6) KEEP QUESTION WITH ANSWER 1. Identify three different schools of Buddhism. How are these schools similar in their beliefs and practices? How ...

Question for the diagnosis of gastroesophageal reflux

Question: For the diagnosis of gastroesophageal reflux disease (GERD), write a prescription for a medication used to treat GERD. Be sure to indicate drug name, strength, amount per dose, route, frequency of dose, amount ...

Interview three 3 individuals of your choosing using the

Interview three (3) individuals of your choosing, using the set of questions you created. Your questions must include: (Responses to these questions will be used in later assignments.) 1) Age 2) Race 3) Ethnicity 4) Gend ...

Overviewin this section you will become more familiar with

Overview In this section, you will become more familiar with some of the identifying features of the Gospel of Matthew, and you will also get a feel for "Matthew's" particular style of writing. Remember that even though ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Please number each questions1 how is the most successful

PLEASE NUMBER EACH QUESTIONS 1. How is the most successful insider fraud perpetrated? Give at least two specific examples. Your response should be a minimum of 225 words. 2. What is the Tor Network? Explain its threats. ...

Discussion assignment -just to be sure we have a clear set

Discussion Assignment - Just to be sure we have a clear set of expectations, it would be helpful if you have a clear understanding of the following regarding the online discussions. The first distinction is that we will ...

Identify specific messages about gender presented in the

Identify specific messages about gender presented in the mass media. Discuss messages about gender you have received from your family or cultural group. Analyze how these messages have influenced your experience with gen ...

Uniform crime report ucrperformance taskscenarioin june of

Uniform Crime Report (UCR) Performance Task Scenario In June of 2016 you begin your first week as an intern at the Happy Town Police Department. As an intern, you develop a good rapport with Police Chief Rodney Hurt. On ...

Discussion questions analyze and critique the safety and

Discussion Questions: Analyze and critique the safety and emergency management structure found in the port environment, and discuss the supporting plans and programs typically found in a major port operation. As part of ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As