Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Obviously, Michelle is upset and would like to negotiate a better shift. From the materials this week, we learned the importance of strategizing and planning for a negotiation. Even before she steps foot into Nikki's office, actions need to be taken in order for the negotiation to start off on the right foot. For this part of the project you will be advising Michelle on how to plan for the negotiation with Nikki. In a 3-4 page paper (you may go longer depending on the length and level of detail in your plan), address the following:

1. Select and support whether Michelle should take an integrative of distributive approach to the negotiation. Be sure to fully define both and argue the pros and cons of each prior to making a selection.

2. Once an approach is selected, the next step is to formulate a plan. A solid foundation to a good negotiation involves creating an effective plan. For this section, create a plan for Michelle in which you address the following points:

  • Define the issues.
  • Assemble issues and defining the bargaining mix.
  • Define the interests of both parties
  • Define the resistance points.
  • Define Michelle's alternatives and select a BATNA.
  • Define Michelle's objectives (targets) and opening bids (where to start).
  • Assess constituents and the social context in which the negotiation will occur.
  • Analyze the other party.
  • Plan the issue presentation and defense.
  • Define protocol-where and when the negotiation will occur, who will be there, what the agenda will be, and so on.

In your paper, follow standard mechanics in grammar, punctuation, and spelling. Provide proper APA cited research: in text and full citations.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91938477

Have any Question?


Related Questions in Homework Help/Study Tips

Question read they say i say textbook the art of quoting

Question: Read They Say I Say textbook: "The Art of Quoting", pages 42-50and "Connecting the Parts", pages 105-118. This reading will assist you with introducing quotes and connecting the ideas in your essay. After you h ...

Question elaborate on the topic for your critical

Question: Elaborate on the Topic for Your Critical Review This assignment will be a continuation of the written assignment from Week One. Research a minimum of three peer-reviewed articles in addition to information from ...

Discussion prison overcrowding has led to an increasing

Discussion : Prison overcrowding has led to an increasing number of alternative programs designed to punish offenders without the use of lengthy incarcerations. Some of these alternative programs include a form of incarc ...

Question overview before writing this paper you will watch

Question: Overview: Before writing this paper, you will watch two movies. Your job is to write a paper that critically compares, contrasts, and analyzes these two movies. In order to do this, you will need to find a them ...

Question project overviewpurpose the purpose of this

Question: Project Overview Purpose: The purpose of this semester-long Project is to demonstrate that you possess the knowledge, skills, and other appropriate capabilities to design a detailed, comprehensive, and plausibl ...

Discussion conflict with teamspart 1 conflict within

Discussion Conflict with Teams Part 1: Conflict within Teams Think of a conflict that occurred in a team you were a part of and analyze it. What were the main sources of the conflict? What interventions can be used to im ...

Cognition in early childhoodcomplete a thorough description

Cognition in Early Childhood Complete a thorough description of Piaget's preoperational stage? Include the basic premise of the stage, the strengths and weaknesses of the theory (based on research, not your opinion), and ...

Answer both of the following prompts-how does social

Answer BOTH of the following prompts. -How does social support influence social control? How does this, in turn, impact criminal behavior? -Explain how to combat crime according to Agnew's theory of Social Concern.

Question write a 500-750 word essay using exemplification

Question: Write a 500-750 word essay using exemplification as a method of development. Include an outline with your essay, but do not use a cover page. Use the MLA format. Writing Approach Determine exactly what point yo ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As