Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Observe three individuals from three points in the life span. Only use subjects you do not know and to whom you are not related. Select one subject from each of the following periods.

Early Childhood (3-5 years of age)

Middle childhood through adolescence (7-19 years of age)

Adulthood (20 and older)

Record at least one example for each of the terms on the Observation Form.

Assign a code name to subjects observed to protect their privacy. Code names usually reflect a characteristic of the subject such as "Miss Eats A Lot" and "Little Blue Shirt."

Locations: Complete observations in a public place such as McDonald's, a classroom, a clinic waiting room, athletic practice, church youth group, retirement center, or a work place.

*Deployed students should inform their instructor of their situation. In such cases children may be observed through movies or parent interviews.

Obtain the signature of an adult in the observation environment as a supervisor. This is for your protection. An adult is then a witness that you are intently observing a subject for academic purposes. If it is difficult to transmit a signature obtain contact information to record on the form.

Record specific, objective descriptions of behavior for each term listed.

This is a clinical style report. List the term and provide the example of the behavior.

Do not state an opinion or make a judgment concerning the behavior. Simply describe the behavior observed.

Allow yourself sufficient time to gather data. Young children move more rapidly and produce a great deal of observable data very quickly.

Older adults may require a longer observation period in order to collect a sample for each term listed.

Submit only objective observations.

An example would be: Receptive Language - The teacher asked Red Shirt to place his coat in his cubby. Red Shirt said, "Yes, mam." He placed his coat in the correct cubby.

Be descriptive and provide specifics such as "Hero could hear his coach call him to come on the field from a distance of approximately 50 feet with traffic noise in the background."

Statements such as "He has a great vocabulary for his age," "She had an attitude toward her mother," and "Bright Eyes was the tallest in her class" are not objective.

Human Observation Project Guidance and ExamplesCompletion of the Human Observation Project will require the observation of various behavioral items including:

Physical Characteristics

Motor Development

Language Development

Social Emotional Development

Please find detailed information regarding each item inside this folder. A brief version is also outlined within the Observation Form.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92540468
  • Price:- $20

Priced at Now at $20, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question what is your idea of the american dream is it

Question: What is your idea of the "American Dream?" Is it attainable in today's society, or just a dream from your parents' generation? This essay needs to be 3 pages long. Since it is an opinion essay, there is no need ...

Project task assignmentdesign project ideasbackgroundthis

Project Task assignment Design Project Ideas Background This is the time to create project ideas. The project is a design problem that includes at least one distinct component for each member of the group. The components ...

What is a annotated bibliography and can you cite some

What is a annotated bibliography and can you cite some examples of annotated biography

Health information technology1healthcareinformation

Health Information Technology 1. Healthcareinformation exchanges (HIEs) are maturing and providing opportunities for healthcare providers and payers to collaborate on patient healthcare records and to streamline care. Th ...

Question in a word document provide short answers to the

Question: In a Word document, provide short answers to the questions below. Each answer should be 250-300 words in length. 1. What role does technology play in emotional and mental status testing? 2. What are the strengt ...

Homework - sensitivity analysis amp basic

Homework - Sensitivity Analysis & Basic Probability Homework Questions: Part A - 1) Questions a. What is a sensitivity study? Why does one perform them? b. What are the three types of sensitivity studies that should be p ...

Respond to two students 300 words each add to the

Respond to two students 300+ words each, add to the conversation not critique their work. Citations in MLA format. First response Virgil's poem The Aeneid begins with "Wars and a man I sing- an exile driven on by fate". ...

Question what are some red flags that would indicate client

Question: What are some red flags that would indicate client resistance? How can you most effectively deal with resistance? Will a client with substance use disorder be more resistant than a client with a general mental ...

Question in this weeks reading we looked at accounts

Question: In this week's reading we looked at accounts, identity, authentication, and account recovery. There is an old adage that says, "You can never be too safe. When it comes to the digital world, it's very true. Cyb ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As