(Answered) Milton rokeach discovered that workers have two sets of

Others

Milton Rokeach discovered that workers have two sets of values. On his Rokeach Value Survey (RVS), he noted that workers have Terminal Values and Instrumental Values.Terminal Values are what you want as your primary goal in life. Instrumental values are the values and behaviors you practice in order to reach your terminal values. For example, if your overall goal in life (terminal value) is to live a comfortable and prosperous life, then you behave in an ambitious and hardworking way (instrumental value).

Share 2-3 examples of where you stand in your own behavior at work or school within the spectrum of terminal vs. instrumental values. Point to specific details and actions. What insights can you share about yourself from this exercise?

View complete question

Homework Help/Study Tips, Others

Category:- Homework Help/Study Tips
Reference No.:- M92051111
Price:- $10

Verified Expert

Priced at $20 Now at $10, Verified Solution

Have any Question?Write your Review or question?

Related Questions in Homework Help/Study Tips

Structurethesis is clear easy to find and appropriate to

Structure Thesis is clear, easy to find, and appropriate to the assignment. Thesis is supported by the rest of the paper. Paper contains a "roadmap" for the reader. There is a logical flow to the topics/arguments. Conclu ...

Question you have all heard the saying about how there are

Question: You have all heard the saying about how there are only two things in life that you must do: die and pay taxes. So far, no one has discovered a cure for death nor developed a way to finance government without ta ...

Question 1a maintenance procedure is added to a new

Question 1 A maintenance procedure is added to a new production line at a facility that manufactures tires. Once a week, a maintenance employee is required to use a step ladder to access a small platform on a mixing box ...

Question compare and contrast the idea that reality is

Question: Compare and contrast the idea that reality is "socially " or "linguistically " constructed. Do you believe these ideas are compatible with a biblical worldview? Explain and support your position. The response m ...

Project - covariance estimation and performance of the gmv

Project - Covariance Estimation and Performance of the GMV Portfolio Suppose you wish to construct a benchmark portfolio with minimum variance, i.e., the Global Minimum Variance (GMV) portfolio. You plan to choose at lea ...

Assignment -need to give demonstration on how airtasker

Assignment - Need to give demonstration on How Airtasker secure? Please prepare 10 slides.

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question need assistance with writing the

Question: Need assistance with writing the following. Instructions: In class we discussed a range of different emotions that can be incorporated into an emotional appeal and tips for doing so effectively. For this activi ...

What was st thomas aquinas impacts and thoughts on the

What was st. Thomas Aquinas impacts and thoughts on the science of psychology?

Question review kurt lewins field theory and process-driven

Question: Review Kurt Lewin's field theory and process-driven change. Using an example of a specific organization, discuss the relationship between a learning organization culture and leadership for complex change. (1 Pa ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Homework Help/Study Tips Expert