(Answered) Medicare-medicaid prospective payment systems for

Others

Medicare-Medicaid Prospective Payment Systems for Inpatients

In this Discussion, review the following concepts pertaining to Medicare-Medicaid prospective payment systems for inpatients: Federal legislations are demanding that healthcare costs be controlled. These demands have led to federal healthcare reimbursement reform.

How do MS-DRGs encourage inpatient facilities to practice cost management?
Is the MS-DRGs approach supported by the healthcare community or is it manipulated by the providers?

View complete question

Homework Help/Study Tips, Others

Category:- Homework Help/Study Tips
Reference No.:- M92713757
Price:- $10

Verified Expert

Priced at $20 Now at $10, Verified Solution

Have any Question?Write your Review or question?

Related Questions in Homework Help/Study Tips

Assignment -how organizational transition and management

Assignment - How Organizational Transition and Management Accounting perspectives Leads to Organizational Success. Chapter One Is "Research process designed - Introduction" Include your personal motivation for doing this ...

Question ecological impactwhen a natural disaster occurs

Question: Ecological Impact When a natural disaster occurs, the impact can be far reaching. Unlike other types of crises or traumas, natural disasters often affect survivors and the environments in which they live. In su ...

Assignment 2 critical thinking essaythe purpose of this

Assignment 2: Critical Thinking Essay The purpose of this assignment is to demonstrate your theoretical understanding of psychological momentum and to also have you research and think about this topic in more detail. Rea ...

Assignment 1 lasa 2 ethical profile paperdirections you are

Assignment 1: LASA 2: Ethical Profile Paper Directions: You are to write an ethical profile paper that recognizes the formative influence of your family, heroes, and personal style on you as an ethical professional. This ...

Question briefly explain what judicial review means in the

Question: Briefly explain what ''judicial review" means in the American legal system and identify the constitutional basis for judicial review? The response must be typed, single spaced, must be in times new roman font ( ...

How do you think obesity impacts a childs development in

How do you think obesity impacts a child's development in the domains of cognitive, social-emotional, and physical development.

Question willy wonka is under investigation for various tax

Question: Willy Wonka is under investigation for various tax crimes. He is the president of Golden Ticket Enterprises, a S-corporation. Beginning in 2013, Willy Wonka, created a Florida corporation, Oompa Loompa Marketin ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Network security assessment - identify network threats

Network Security Assessment - Identify Network Threats using Network Security Tools Purpose of the assessment - The objective of this assignment is to identify network threats using network security tools. The purpose of ...

Write a paper on one of the following prompts1 poetry in

Write a paper on one of the following prompts: 1. Poetry in Plato and Aristotle: Plato in the Republicand Aristotle in his Poeticsdiscuss story-telling, poetry, and its influence on the public. Thoroughly explain Plato's ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Homework Help/Study Tips Expert