Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

linked item M6A3: Pain Management for the Obstetric Patient Paper

Helping a woman manage discomfort and pain associated with pregnancy, labor, birth and recovery from birth is an essential role of the registered professional nurse.

Using APA format, write a six (6) to ten (10) page paper (excludes cover and reference page) that addresses the comfort and pain relief needs of the antepartum, intrapartum and postpartum patient.

A minimum of three (3) current professional references must be provided. Current references include professional publications or valid and current websites dated within five (5) years. Additionally, a textbook that is no more than one (1) edition old may be used.

The paper consists of two (2) parts and must be submitted by the close of week six.

Part one (1) looks at the causes and management interventions of discomfort and pain during pregnancy, labor, birth and recovery from birth. Part two (2) is a component of a teaching plan the registered nurse would use to assist an antenatal patient make an informed decision regarding pain relief measures to be used during labor and birth.

Part 1

A. Identify and explain two (2) sources of pain for the antepartum patient, intrapartum patient, and postpartum patient during an uncomplicated pregnancy, labor, and recovery from the birthing process.
B. Identify one (1) pharmacologic and two (2) non pharmacologic pain management measures for the intrapartum patient. Explain the benefits and risks of each of these pain management measures.
Part 2

In order for the woman to make an informed decision regarding pain relief measures to be used in the intrapartum period, the information needs to be provided in the antepartum period.

Before finalizing a teaching plan for the pregnant woman, her history needs to be assessed to determine any variables that may affect the content of the teaching plan. For example, are there any language variables/barriers that will affect care provided during labor and birth?

A. Identify three (3) variables unique to the pregnant patient that need to be considered when developing a patient specific pain management teaching plan for the antepartal patient preparing for labor and birth. Provide an explanation why each of these three (3) variables needs to be considered when developing a teaching plan for an obstetric patient.
B. Select two (2) non-pharmacologic pain relief options used in the intrapartum period. For each option, explain three (3) specific points of information related to this pain relief option that needs to be taught to the patient. Include rationales for each piece of content regarding why you would need to incorporate this information.

Compose your work using a word processor (or other software as appropriate) and save it frequently to your computer. Use a 12 font size, double space your work and use APA format for citations, references, and overall format. Information on how to use the Excelsior College Library to help you research and write your paper is available through the Library Help for AD Nursing Courses page. Assistance with APA format, grammar, and avoiding plagiarism is available for free through the Excelsior College Online Writing Lab (OWL). Be sure to check your work and correct any spelling or grammatical errors before you submit your assignment.

You are required to submit your paper to Turnitin (a plagiarism prevention service) prior to submitting the paper in the course submission area for grading. Access is provided by email to the email address on record in your MyExcelsior account during week 2 of the term. Once you submit your paper to Turnitin check your inbox in Turnitin for the results. After viewing your originality report correct the areas of your paper that warrant attention. You can re-submit your paper to Turnitin after 24-hours and continue to re-submit until the results are acceptable. Acceptable ranges include a cumulative total of less than 15% for your entire paper, and no particular area greater than 2% (excluding direct quotes and/or references).

See the videos below for instructions on how to submit your paper to Turnitin and view your Originality Report.
Video - Submitting a Paper
Video - Viewing Your Originality Report

When you're ready to submit your work for grading, go back to the top of this instruction set and click on the bolded title for the assignment to access the Submission Area of the assignment, then click Browse My Computer and find your file. Once you've located your file click Open and, if successful, the file name will appear under the Attached files heading. Scroll to the bottom of the page, click Submit and you're done.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92474596
  • Price:- $10

Priced at Now at $10, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question identify a topic for research paper and submit an

Question: Identify a topic for research paper and submit an outline to the instructor. The paper should address a strategic business decision using relevant economic factors. The paper should be 10-12 pages long, with ma ...

Assignment 2 critical thinking essaythe purpose of this

Assignment 2: Critical Thinking Essay The purpose of this assignment is to demonstrate your theoretical understanding of psychological momentum and to also have you research and think about this topic in more detail. Rea ...

Please respond to the following discussion questions you

Please respond to the following discussion questions you can ask technical questions or respond generally to the overall experience. Be objective, clear, and concise. Always use constructive language, even in criticism, ...

Question as you are probably aware the rate of diagnosis of

Question: As you are probably aware, the rate of diagnosis of Autism and related disorders is increasing significantly. Watch the video above and do an internet search of some of the recent articles published on this top ...

This paper must be 4-5 pages double spaced and do the

This paper must be 4-5 pages double spaced and do the following: The specific contemporary issues are: Dark Tourism, Over Tourism, Growing global insecurity and terrorism. A specific example of this issue currently occur ...

Question theory assists psychologists in better

Question: Theory assists psychologists in better understanding human behavior, emotion, social skills, and overall mental health. In essence, theory helps us to better understand human psychological functioning, which em ...

Read the case story of a day in the sleep clinicafter

Read the Case Story of A Day in the Sleep Clinic After reading the story, click on the Activities link on the left side. Review Activity #1. Address the following in a paper: 1. What aspects of Dr. Williams' behavior inf ...

Comments 1 the first thing the researcher needs to do

Comments: 1. The first thing the researcher needs to do before organizing his/her qualitative data is to determine which sources of information will be used in their literature review. One reliable source of information ...

Assignment -the advanced service management fead49 course

Assignment - The Advanced Service Management (FEAD49) course gives you an overview of the key theoretical concepts frequently discussed and debated in the field of service research. In this individual assignment, you sho ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As