Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Journal of Adolescent Health (2009) 335-341

Schilling, E. A., Aseltine, R. H., Glanovsky, J. L., James, A., & Jacobs, D. (2009). Adolescent Alcohol Use, Suicidal Ideation, and Suicide Attempts. Journal of Adolescent Health, 44(4), 335-341. doi:10.1016/j.jadohealth.2008.08.006

Summary

The rationale of the reviewed article is to examine the association between self-reported alcohol use and suicide attempts amongst youngsters who did and did not account suicidal ideation during the past year. 2 types of alcohol use were reviewed: heavy episodic drinking and also drinking while down. There was regression of Self-reported suicide attempts on suicidal ideation and both procedures of alcohol use, controlling for participants' levels of depressive symptoms, and demographic characteristics. Logistic regression analyses showed that both heavy episodic drinking and drinking while down were considerably associated with self-reported suicide attempts. Analyses examining the conditional association of alcohol use and suicidal ideation with self-reported suicide attempts exposed that drinking while down was associated with extensively greater risk of suicide attempt among those not reporting suicidal ideation in the past year.

Critical Evaluation

Even though present data are somewhat precise on the prevalence of adolescent suicidality, depression, and alcohol use, only tentative conclusions can be taken as earlier research has been loaded with methodological problems, generalizeability constraints, and mixed conclusions. On the basis of these restrictions, the result from the majority of the reviewed studies can be considered evocative rather than assenting. The foremost criticism of a lot of the present literature integrated in this review is the utilization of diverse methods or appraisal tools with diverse trustworthiness and legitimacy. Comparing outcome across studies was intricate and probably improper since there was no single measure or steady definitions of suicidality, depression.  For instance, while depression may be acknowledged as a sole clinical identification or as an indicator, rates of depression be different in accordance with type of measure utilized or how depression is defined. Consequently, using the term "depression" to represent each one of these definitions is deceptive and an incorrect depiction of what the youngster may be experiencing. The cross-sectional studies were forbidden from creation any causal statements about the sequential relationship among suicidality, depression, and alcohol utilization. One more criticism was that a number of the longitudinal studies compared data over a short period of time, of not more than 2 years, that cannot explicate the effects of maturation which may influence the result of the studies. The utilization of clinical samples restricts the generalizability of the outcomes to the common population. This deficiency on the basis of theory research fails to develop or enhance our capability to check teenager suicidality in a defined scientific milieu. A methodological constraint of the greater part of the studies was the special use of self-report data, particularly on things that were susceptible in nature. It is hard to recognize the level to which the reports were perfect images of the variables being analyzed or an outcome of being suicidal, depressed, and/or an alcohol user.  To date, there is merely narrow data available, with conclusion that are frequently indecisive, concerning an independent impact of ethnicity on the 3 youngster phenomena of suicidality, depression, and alcohol use.

JUST 300 WORDS PAPER.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92490172

Have any Question?


Related Questions in Homework Help/Study Tips

Question prompt dayer-berenson ch 31 as we conclude this

Question: Prompt: Dayer-Berenson, Ch. 3 1. As we conclude this course, can you define the primary and secondary characteristics of your own culture? Can you describe the characteristics of you race and your ethnicity?

Question using ebph to define and quantify the extent of

Question: Using EBPH to Define and Quantify the Extent of the Public Health Problem Note: Your response and comments to this assignment will be laying the foundation for work that you will later complete as part of your ...

Multiple relationship presentationthere are many situations

Multiple Relationship Presentation There are many situations that may present in counseling as multiple relationships or boundary issues. In order to deliver the best quality of care for your clients, it is important to ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Explain how nurture and nature play interactive roles in

Explain how nurture and nature play interactive roles in shaping behavior.

Comparative programming languages assignment - parallel

Comparative Programming Languages Assignment - Parallel Implementations This assignment will test your skills in programming applications to specification in a number of different programming languages. Assignment Overvi ...

Technology your text shares many negative effects of

Technology Your text shares many negative effects of technology and the media's influence on children. Regardless, technology is increasing rapidly and is only becoming a larger portion of our children's lives. After rea ...

Question note total 6 slides without including references

Question: Note: total 6 slides without including references with APA and without plagarism Part 1: Effect of Culture on Teams Review at least four academically reviewed articles on how cultures affect team management. De ...

How do sanctions work why are they so effective in

How do sanctions work? Why are they so effective in maintaining social order? To address these questions, you will violate a social folkway. Select one of the options below. You may not choose something that is not on th ...

Assignment - practical assessmentscenariouser modelling

Assignment - Practical Assessment Scenario User Modelling Inc. would like to organize a series of conferences focusing on research topics in the area of user adaptive systems and personalization. They need to organize an ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As