Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Journal Assignment

Reflect on your own thoughts and feelings about animal testing. Do a quick article search on animal testing. Review one article that is pro-animal testing and one article that is anti-animal testing. Discuss two of the pros and two of the cons of animal testing that were discussed in the articles. In researching both sides of the debate, has your perspective shifted any on the animal testing debate? Explain.

Your journal entry must be at least 200 words. No references or citations are necessary.

You will be required to complete the Unit VI Case Study. Your job is to propose the testing that is needed for a new drug to be determined as safe and effective for the treatment of cancer in humans. Your case study assignment should be three to four pages in length and utilize at least three reliable references. Use APA style guidelines in writing this assignment, following APA rules for formatting, quoting, paraphrasing, citing, and referencing. Please be sure to review both the assignment in the syllabus and the grading rubric. Good luck!

Recent studies support the potential of a drug that is derived from the metal iridium to effectively treat cancer. This experimental drug, Drug ZL105, has not been tested for efficacy and toxicity. Imagine that you are the one responsible for approving or denying the use of this drug within the United States. Your job is to propose the testing that is needed for this drug to be determined as safe and effective for the treatment of cancer in humans. In your research and discussion, you should address the questions below.

1. What model(s) will you use for testing (i.e., animal, cell cultures, computer simulations)? Explain the choice of model, and provide support for the reliability of the model. Discuss the pros and cons of your choice.

2. In determining the safety and effectiveness of the drug, would it be necessary to test efficacy, toxicity, and lethality? Explain what each of these tests are for and whether or not one or more of the tests are necessary for your determination.

3. Provide your thoughts on what information you hope to gather from your tests and whether or not the same protocol should be used for various categories of products such as drugs, cosmetics, and herbal medicines.

Your case study assignment should be three to four pages in length and utilize at least three reliable references. Use APA style guidelines in writing this assignment, following APA rules for formatting, quoting, paraphrasing, citing, and referencing.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92585275
  • Price:- $55

Priced at Now at $55, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Discussion 1 you must first review the nab company

Discussion 1: you must first review the NAB Company Portfolio. The mentioned portfolio contains the company parameters and details you must follow when developing your company. Provide the following information to set th ...

For the purposes of this assignment assume that the major

For the purposes of this assignment, assume that the major gift prospect has already been identified and researched to determine gift ability and affinity to the purpose for the gift. Also, a Board member knows the prosp ...

Assignment - strategic innovation simulation back bay

Assignment - Strategic Innovation Simulation: Back Bay Battery Instructions - 1. Complete the following simulation -- "Strategic Innovation Simulation: Back Bay Battery," Harvard Business Publishing Simulation - 7015-HTM ...

Question read the you be the judge on p 359 of the text it

Question: Read the "You Be the Judge" on p. 359 of the text. It is the case of Gulino v. Board of Education of the City School District of New York. Review the facts, and the arguments of each party in the case. Discuss: ...

Question code of ethicsprior to beginning work on this

Question: Code of Ethics Prior to beginning work on this assignment, read the articles The Contributions of Credentialing and the Code of Ethics to Quality Assurance in the Health Education/Promotion Profession  and Does ...

Assignment 2 discussion-examining my own

Assignment 2: Discussion-Examining My Own Organization Whether it is your first job or your continuing professional growth, training and development is a large part of your work experience. You will have some sort of exp ...

Question choose one of the four following visuals1 image

Question: Choose one of the four following visuals: 1. Image courtesy of: Nike® 2013 advertisement 2. Image courtesy of: Parents magazine June 2011 3. Image courtesy of: Harley Davidson® advertisement 4. Image courtesy o ...

For this assignment you will write a two full pages essay

For this assignment, you will write a two full pages essay, addressing the issues below: 1. Explain how crime and mental illness are related from a legal standpoint. 2. Find three court cases which are related to mental ...

What is reductionism and how does the psychological level

What is reductionism and how does the psychological level of analysis relates to the biological and sociocultural levels of analysis?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As