Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

John has returned to your ward after having his total knee replacement surgery and you are the nurse taking over his post-operative cares.

Choose ONE of the topics listed below - Post op respiratory infection OR Post op deep vein thrombosis (DVT).

Search the literature for at least 10 recent [less than five years old] research journal articles or systematic review papers related to the topic you have selected.

Write an essay of 1500 words in length in response to the following essay criteria.

Use current evidence to support your discussion on the topic.

Refer to the marking criteria to see how many marks are allocated to each section and to get further information on the assignment structure.

Use the APA 6 Referencing style and the School's assignment formatting guidelinesWritten Assignment: Essay

Word Count: 1500 Words

Aim:

The aim of this essay is for you to demonstrate an ability to apply theoretical knowledge to plan effective evidence-based, person-centred care for a client with an acute medical or surgical condition, in line with the NMBA (2016) Registered nurses standards for practice.

Assessment description:

Consider the following client scenario:

John Grant, a 63 year old man has been diagnosed with bilateral knee osteoarthritis. His GP added Endone 5 mg prn but due to his worsening pain, mostly in his right knee, John was referred for a right total knee replacement and a plan to have the left knee done also, once he was fully recovered from the first operation. He has a history of angina, hypertension (HTN), hyperlipidemia, type 2 diabetes (T2DM), and depression.

John is widower and owns a café, along with his eldest daughter. He previously worked 6 days / week however due to his painful knees he has reduced his work to light duties and office work 2 days/week and now worries about his daughter's workload. John lives in his own home, which has six steps at the front, and is usually able to do all his own Activities of Daily Living (ADLs) and household work independently. His family visits regularly, and recently his son and daughter-in-law have been helping with the housework and cooking.

John has returned to your ward after having his total knee replacement surgery and you are the nurse taking over his post-operative cares.

1. Choose ONE of the topics listed below - Post op respiratory infection OR Post op deep vein thrombosis (DVT).

2. Search the literature for at least 10 recent [less than five years old] research journal articles or systematic review papers related to the topic you have selected.

3. Write an essay of 1500 words in length in response to the following essay criteria.

4. Use current evidence to support your discussion on the topic.

5. Refer to the marking criteria to see how many marks are allocated to each section and to get further information on the assignment structure.

6. Use the APA 6 Referencing style and the School's assignment formatting guidelines

TOPICS: Choose ONE of the following post-operative conditions

For your chosen post-operative condition address the following criteria.

A. POST OP RESPIRATORY INFECTION

1. Provide an overview of the patient:

? Briefly outline their current condition and include some basic pathophysiology.

? Discuss other relevant medical history, social environmental and family situation.

? Identify and discuss risk factors (in other words what might go wrong to cause a respiratory infection and why).

? Use scholarly literature to support your discussion.

2. Comprehensive assessment

? Discuss 2 areas of the systematic assessments relevant to the client and their associated condition.

? Include in your discussion 2 risk assessments that may be relevant for this client, including why they were chosen.

? Refer also to culture, ethnicity, family and the inter-professional team.

? Use scholarly literature to support your discussion.

3. Plan nursing care based on your assessments of the patient

? Discuss 2 specific strategies to meet the client's needs identified in the assessment.

? From your analysis of the literature, propose and justify a plan to prevent a post- operative respiratory infection in this client. (i.e., make a case for what is best practice based on your reading, and provide supporting evidence).

? Compare and contrast differing views that you found in the literature and construct an argument for what you think is best practice (i.e., evidence-based) in this particular scenario.

? Use scholarly literature to support your discussion (i.e., journal articles and contemporary sources).

4. Evaluationof care

? Discuss any inter-professional collaboration that may be required to manage the patient whilst in hospital or at home.

? In your own words, and using reflective practice, discuss strategies to evaluate the plan of care.

B. POST OP DEEP VEIN THROMBOSIS (DVT)

1. Provide an overview of the patient

? Briefly outline their current condition and include some basic pathophysiology.

? Discuss other relevant medical history, social environmental and family situation.

? Identify and discuss risk factors (in other words what might go wrong to cause a DVT and why).

? Use scholarly literature to support your discussion.

2. Comprehensive assessment

? Discuss 2 areas of the systematic assessments relevant to the client and their associated condition.

? Include in your discussion 2 risk assessments that may be relevant for this client, including why they were chosen.

? Refer also to culture, ethnicity, family and the inter-professional team.

? Use scholarly literature to support your discussion.

3. Plan nursing care based on your assessments of the patient

? Discuss 2 specific strategies to meet the client's needs identified in the assessment.

? From your analysis of the literature, discuss and justify a plan to prevent a post- operative deep vein thrombosis (DVT) in this client. (i.e., make a case for what is best practice based on your reading, and provide supporting evidence to back it up).

? Compare and contrast differing views that you found in the literature and construct an argument for what you think is best practice (i.e., evidence-based) in this particular scenario.

? Use scholarly literature to support your discussion (i.e., journal articles and contemporary sources).

4. Evaluation and of care

? Discuss any inter-professional collaboration that may be required to manage the patient whilst in hospital or at home.

? In your own words, and using reflective practice discuss strategies to evaluate the plan of care.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92264565
  • Price:- $50

Priced at Now at $50, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question - from the e-activity examine ethical behavior

Question: - From the e-Activity, examine ethical behavior within firms in relation to financial management. Provide two (2) examples of companies that have been guilty of ethics-based malfeasance related to financial man ...

Question community culture and nursingtopic 2 culturally

Question: Community, Culture, and Nursing Topic 2: Culturally Competent Care A broad range of cultures exists in the world today. Nursing professionals often interact with people from cultural backgrounds that differ fro ...

What is an example of relative dating and an example of

What is an example of relative dating and an example of absolute dating in geologic time. How can we determine the age of a rock.

Question details rate yourself using the results from the

Question: Details: Rate yourself using the results from the "Nurse Manager Skills Inventory": Write a reflection of 750-1,000 words in which you identify your strengths and weaknesses related to the four content areas be ...

The media and public trust please respond to the

"The Media and Public Trust" Please respond to the following: Discuss one or two reasons it seems that the media have lost the public trust in the U.S. Debate It - Take a position on this statement: Democracies need an i ...

Question sustaining change can be difficult as there are

Question: Sustaining change can be difficult, as there are many variables that can affect implementation. One critical component of EBP is to ensure that practice change is part of an organization's culture so it will co ...

Question what do you see as the primary difference between

Question: What do you see as the primary difference between operating exposure and translation exposure? Would this have the same meaning to a private firm as a publicly traded firm? Why or why not? Your initial post mus ...

Discussionno need for cover sheete-activity how mass media

Discussion: No need for cover sheet. e-Activity: How Mass Media Influences our Society (youtube) 1. "Do Media influence Society?" Please respond to the following: • From the e-Activity titled above "How Mass Media Influe ...

Policy memocriminal justice reformassignment

Policy Memo Criminal Justice Reform Assignment Instructions Imagine you are a state or city government policy adviser. The governor or city mayor has asked your boss to brief them on a critical problem facing your commun ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As